Open Close
General Information
Symbol
Dmel\oys-RB
Species
D. melanogaster
Annotation Symbol
CG18445-RB
FlyBase ID
FBtr0339416
Feature type
Associated gene
Evidence Rank
Length (nt)
3850
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 76 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCTATTGCGTTTCGAATATTTCATTTATACGCACGGGTACGGTAGACTCGATCCAAACAGACAAACGTTCAAAATTATTG
        CACAAAATTATAAGTAAACACCCCGCGTCCACCCCACCGCCCATATTGGGTACCTCGTGTTTTCGGTGGTTCCCTGAAAT
        ACCGGAAAAGTGTCTGTTAATCGTGAAGTTTTCCTAATGAAGCACTGAAACAGAACGACCGACAGCAACAACAACGCAAC
        AGAAAAGAGTGGATAAAGAAAACAGACAGCAAAATGCTAGAACCGCCGAAATTTATAGAGAATGATTGCTACAACGGCAG
        CCGGACCTTCACTTGGCTGGCGGATATGGTGGGCCTCTCCGTGGACTTGGTAAACTTTTTGATTTGCCAAATATCTGCTC
        TCTTCCTGGCCTCGCTATTTCGGTCGATGCTGCATCCTTCGAAGGTTTCCAGCAAATTGCGCCACACATTCGCCCTATCG
        ATTGGCCTGGCCTTCGGCTACTTTTGCTTTGGTCAGCAGGCAATCCACATTGCCGGATTGCCGGCAATATGTTACATCGT
        TATCCGCACCCAAGATCCACGTATTGTCCAAAGAGCCGTCCTGCTGGTAGCCATGAGTTATCTGCTGTGCGTACATTTGA
        TGCGCCAGCTTTACGACTACGGATCCTACGCCCTGGACATAACCGGGCCCCTTATGATCATCACTCAGAAGGTAACCAGC
        CTGGCGTTCAGCATTCACGATGGGTTTGTGCGGGGCGATGAGGAACTCACCAAAGCGCAACAGTACCACGCCATCCGCAA
        AATGCCCTCTGCTTTGGAGTACTTCTCCTACGTGTGGCACTTCCAAAGCATCCTAGCCGGTCCTCTCGTTTTCTACAAGG
        ATTATATCGAGTTTGTCGAAGGCTACAATTTGCTTAGTACTCCACCGGGCAATGGAAATCTCGACAGCAGCAAGAGAGAA
        GTAGTACTGGAACCTTCGCCTACTAAAGCGGTAATACGTAAAGTAGTTGGTAGTCTTGTGTGCGCTTTCATCTTCATGAA
        GTTCGTGAAAATATATCCCGTGAAAGACATGAAGGAGGATGACTTTATGAACAATACCAGCATGGTTTACAAGTACTGGT
        ACGCCATGATGGCTACCACCTGCATACGCTTTAAGTATTATCACGCCTGGCTCCTAGCGGATGCCATATGCAACAACTCA
        GGTCTAGGTTTCACCGGCTACGATAAGGATGGCAATTCCAAGTGGGACCTGATATCTAACATCAATGTGCTGTCGTTCGA
        GTTTTCAACGAACATGCGCGATGCCATCAACAACTGGAACTGCGGCACCAACCGCTGGCTGCGAACGCTTGTCTATGAAC
        GAGTGCCCCAGCAGTACGGCACGCTCCTTACCTTCGCCCTCAGCGCCGTCTGGCACGGCTTTTATCCGGGCTACTACCTG
        ACCTTCGCCACCGGCGCTGTCGTTGTAACGGCTGCGCGCACCGGCCGGCGACTCTTCCGTCATCGCTTCCAGAGCACGCA
        GGTCACGCGAATGTTCTACGACATCCTCACCTGCCTGATCACACGCGTCGTACTGGGCTACGCCACATTCCCATTCGTTC
        TGCTTGAATTTATGGGCAGCATCAAATTGTACCTGAGATTTTATTTGTGCCTTCACATCATTTCACTAGTGACCATATTT
        ATTTTACCCAAGTTTATACGCGGCGAACGCCGGCTTCGGACGTCGAATGGCAACGGAAACGTGCGCTTGTCGGGCAGCGG
        CAATACCAAGGATGCAGTGACCACTAGTGTGGAGTCTACGGCAGCCCTAACCGCTGGCAATGATCTCAACGAGGATAAAG
        AGGAGGATAAACACGCTCAATGTAAAGTCCACACGCCCACACAACAGCAGCCAGCTGCTGGCCCACACAAAACAACCGTA
        GAACAACCAACCGAGCAACCAAACAATGTAAATCTTCGATCACGCCCACAGCAGCAGCAGCCACATCTCGAAAAGAAGGC
        AATGCCGCCCACATGCGCCCGGGACGCGGTTAGTGTTCCTCATGACCAATGCGAGATGGATCAGTTGTCCAGCAAGCTTA
        AGGAGAAGATCGAGGCGGAGACCAAAAACATAGAGGAGTTTATTGATAAGACTGTTACCGAAACCGTGAGCGGCATTGTA
        GAGTTCAAGAACGACCTGATGCGGGACATCGAGTTCCCCAAGTTAAAGCTACCCGGCAGCAACGGGGCAATTTCTTTGGA
        CTCTTCAAATGGCGGTGGGCTGCGCAAGCGCAACATATCCTCTGTCCATGACAATGGCACAGATCCTGGCCATGCTACCG
        CTGACCTCCATCCTCCTCTCGAGGAGAATGGCGCCGCCTTTCTAAAGAAGGAGATCGAGGTAATCAACGCGGTGGTGCAA
        CAAGCAGTGCCGGCAGTGCTTAGCAACGGTCATGCAAAATAGTAGCATTGGCCAGCAAGTGTGAGGAGATCGAACAAAAC
        AACGAGGACGAGGGTGGAACGGCAGGGATTGGAGGCAGTCAGGGGCCAAAATGGGTGCTCCATATCTGATTGATTGATTA
        ATATATACACTGCGAGAATTATCCAATGCGCACACGATATTCGCACACTCCAAACAATTGCAACAACTTTTGGGTTTCTC
        ATTTAATAAATCGTTTTCGTTGACAATCCTGAAGTAAAGAAATTGTTTACCCTAATGCAAGTTTTTAGGACGGCTGATTA
        TTAAAGAAATAACTAAAATACACTAACATACTCGATATGTTCATCAGCAGCTAATACCCTTGTTTAAATGTGCACAAAGT
        CTCTAATTGTTGTTGAAAAAATCTATATACTTTTATAGTTGTTTATTTGTTAATATCCCATGGCCTGATACGAACAGTGC
        GTTTTAACCATACCCGACACATATCCGCTAGAGTAATTAAAATCCTGAAAAAGTTAAGAAAATCGACAGGTATGTATGCA
        CGTCGATTACCAGACAAGGGAAGGCAGCCAAAACTTTTTGATAAGTTTATTTTAAAAAAGAAACCCAGAACAAGAAAACT
        AAAAACGCACTGTTTGAGTCACGACTTTTATCGAAAACTAATCCATATATATGTAAAAGCCTGCATATGTTAAAATGTTT
        ACCATATAGTCTATGTGCGAACTAAAAAAAATTTTTCAGTATCATTACTATTGTAGTTCAAATCCCGCCCGAAGGAACAA
        CAACGTGACAAGTAGAACCAATGTTATCATCTTCAATTTAAAAACAAAAGCCTAAACAAAAGTCAACCAAATCCTAACTT
        TAGACTGAAGCTATTGACATTTACTAAGCAAACAAAAAGCAGAACGTGCGTAGATAAAGTTAGTTAGTAAGCCGTCAAGT
        TGATTTTGATATTATATTTAAACCAATTCTTGTACAAGTGCGTAAGAGTGTCTGGACAGGAGTACCGGCATGCTCCACAT
        TTGTATATCCTTTCCAAACCGGCCTATTAGCTGGCTCTTTTTGTACATGTTCGTGTCCTCCACTTGTGGCTTCCTACTCC
        GTAGCTCTTAAGCATGCTCTTTATATAACCTTTTTGTTTTACCCATTAATTTGTTAAACCCAATAAATGATTTTTCCCGA
        AATCCTTACACGTAATCGATATATTTTTATATTTATTGTAATGAAGAGTCGGAAACAAAACCACTCCTACCGTGAGCGAA
        ATCTCAGAGCACATTTGTCTTGAAGTCGTAGTTTTCTCCTGGAAAAGCGCCGGAGAAGATTTCGACAGGCACATCACTAA
        GGTGTTAAGCAGTCCAGTCGCCTAAGATATACAAAACCAATTTGATCATTGATATTCGAAAAATAAATCGTATATGTGTA
        ATTTACATTG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0088434
        3613
        FBtr0345629
        3556
        FBtr0345630
        4791
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0308504
        722
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0087520
        722
        FBpp0311693
        702
        FBpp0311694
        722
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        oys-RB
        Secondary FlyBase IDs
          References (0)