Open Close
General Information
Symbol
Dmel\meso18E-RD
Species
D. melanogaster
Annotation Symbol
CG14233-RD
FlyBase ID
FBtr0339436
Feature type
Associated gene
Evidence Rank
Length (nt)
2619
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GTTCAGTTTCAGTTTCGTTGTTGTTTGGTTTGGTTAGTTTTAGTTGGTTAGTTGGAATCTCAGGACGGCGGACTACGGAG
          AACGGTAAATCGCGTGCAGCGTTGTCCGGAGGAAGAGAATTGCGCTCGCGTTTTCTTTCCACCTTTCTTCTCCACTCTAC
          TTTTCGCTCAGTGCAAATGCAGGCACACACACGCACAATCGCCACGCTCTAGACGTTAAGTGTCACAAAGGTTACATTGC
          GTTCACACTAGTTACATTTGAAATGCAAACGCCGCCAGGCCAACGCAGCATCCGCAAAAACAAACACAAAAACATAAGCA
          ATAACAACAACAACAACAACGAGCAGAGCCGGAGAGTCCACAATTGAAACACTCGAAAGAATCTGCAGCGGATCGGAGAA
          GAGGATAGCAGCAGCAGAAATTAGACAATATCACCGTCCAGCATTGCGCCTGCTCAGCAGAATCGGGCCATCCAGAAGCT
          GCTGACACCACAGAATTCCCAAATGGATACGAAGAATCCCCCGCCGGTGACGAGCAGCTATCACCACCAGCGGGCGCCGC
          GGACGCCGGAATCGTACTTCAACGTGCCGGAGTCGGTGGCCCTGCTGAACATCGTCAAGTCGGAGCGCATCCAGAGCGCG
          TTCCAGTCGAACCGAAAGAACCATGCCAGCGTGTGGGAGATGGTCGCCGAGGTGCTCAACCGCTTCAGTGCGCGGAAGCG
          AACGGCCAAGCAGTGCTGCAATCGGTACGAGAACCTCAAGAAGATCTACACGCAGCTGAAAAAGAATCCCGAGCGCCATG
          TGCGCCGCAACTGGCCGTACATGTTCCTCTTCAAGGAGATCGAGGAGCAGCGCGGCGAGTGCTGGGGATCGAATGGCAAG
          CGTCTGGCGCTCATAACCAAAAACCACAACGAGCTATCCTACTACCAGCGCCGACGGCAGGCGGCCGAGCTGGGAGTGCT
          GCTCAACAAGGACAACCTCACCCCGCACCAGCACAGCCTACTGCAGAGCCTCAGCCAGAGCCAGAGCCAGAGCCACTCGC
          ACGCCCACTCCACGGACTCCTCGCAGAGCGGGAGCAAGCTGGACCGCTTCCTGCCCAATCACTTTGTGGAGGCGCAGCTC
          AGCGAGGTGGCCGGCCCGGTCGGTGGCTCCGCATCCGGTGTATCCGGCATGTCCGCCGGCGGCTTCGACGAGAATCCCCT
          CCAGATGCAGATGGTTCAGGCAGCTGCTGCCGCTGCCGCCGTGGCCGCCCATAAGCGACATGAGCTCCAGATGGCCAGCG
          TTGGCGGCGTTCAAATGACGCCCGAAGACGACGACGAGGATGAGCCCCAGCGGCCAGCATTTAAAAACCACCTTCACGTC
          CTGGGTCATGGCCACGGCCTCGGCTTGGGCCACGCGCCAATGGACGACTCTGGCGAAGCACCCGACTTCGAAAAGGACTG
          CAATGGAGCACTCAACATGCACCACCAGAACAACAATCACAACGAGAACCACATATCAATGAAGTCGGAGCCACTTTCGG
          AGGGCGAGTTCAATCCGGACGACATCCAGCTGATGCAGACGAACTACAATGGAGCGCAGAACTACTATTCGCCGGGCATG
          GATGCGAATATACTGCACCCCGATGTGATCGTCGACACGGACATCCTGTCCGACTGCTCCTCATCGACAACGCTGAAGAA
          GAAGCGCAAGATGTCCACCTCGACCGACGGCGACAGCACCAATTACGAGCTGATCGAGTATCTGAAGCGGCGCGAGAAGC
          GGGACGAGGAGCTCCTCAAGCGGATGGATGCGCGCGAGGACCGGCTGATGAACCTGCTGGAGCGCACGGTTGTGGCCATT
          GAAACGCTGGCCGTAAAGCGGGCACTTACGTTTCCAGTTAATCCAACCAAAGAGAACGCGCCAGCGACAGCCAGACCGTT
          GTCTCCGCCACCACCAGAGGCTCAGTTTGCAGCGCCGCCAGCTACGCAGGAGCAGCCCACCAGTCCGGAACGCAACGGCA
          TTGCGACAGGCAGGAGCGGCACCATTCCCGTCGCGAATCAGGATGCCGCCATTGAGGTGCCAGACGACGGCGATAGCGGT
          GACGATGTTCAGGTGAAGGACAAGCTGGCCAAGCTGACACCAAAGGCTGGCGGCGATGAACGGACGGATGGCAGGCAGAC
          GTAGAATATAATGCATCCACTACTCGCTAGATCTACTTAAGACTTCTACCTACATACATATATATATATATAACCCTTCC
          CTACCGCCACTCCTCTCACCGGATGGCGGCAGAGGATACAGTGCCAAAGAAGAGCCATGTCTCGAATTTCAGTTGAGATT
          GCCATTTTTACTTAGAGAGCCTACACAAGTGCTTAGCGGACGAATGAAACTTAATTGCAATGTTGAATATTAAGCGCCGC
          AATTTTTGTTGAAGCGATAATCTTAATTCACTTAATTAGCTTTTAGTTAGGCGGAATCCCACCAGCGGATGCCGAATGAA
          TCTCAACAGAGCCGGATTCACACCGCTACGATAATCTAGTTGGAGCTGCAACGGGGCTCAAATGCATTTGTGCAGTAACT
          AAAGCACAAACATTTCATTTTTTTTTTTTGTAATCTAGATGAATACATGTACCATTTAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0074812
          2521
          FBtr0301703
          3096
          FBtr0339435
          2588
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0308523
          553
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0074581
          553
          FBpp0290917
          553
          FBpp0308522
          553
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          meso18E-RD
          Secondary FlyBase IDs
            References (0)