Open Close
General Information
Symbol
Dmel\achi-RD
Species
D. melanogaster
Annotation Symbol
CG8819-RD
FlyBase ID
FBtr0339635
Feature type
Associated gene
Evidence Rank
Length (nt)
2277
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 12 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CACCTAAAGAAACTAAAAAGTGACAGGTTTCTCTGTTTGTAAAAAAAAAAAAATTCTTAAGTCTGAGCTGCAATGATCTC
          GCCGGAACAAGAAGAGGTCAACATGGTCCTGGATCGCCATGTACGGCAGAATATCCAGGACATGATGCACGAGGCTCATG
          TCCAGGCGAGCCTGCTGGAGAACGAAGGACGCGGCCGTTTCCACTCGGACTCAAGTTTGGACCAGGATTCTCTTCACGCT
          GACGTCATCGTGGAGGAGGATCAGAGCACCGAACACGGCGCCAACCAGGTGCAAAACTACCACGACATGATGGTGGACAG
          TGAACACCACATCGACATAAATGGGTCGCTGCGCAAACGTCGTGGAAATCTTCCCAAGACCTCTGTAAAGATTTTAAAGC
          GTTGGCTTTATGAGCACCGCTATAACGCCTATCCGAGCGATGCGGAGAAGTTCACCCTGTCCCAGGAGGCCAATCTGACG
          GTGCTCCAAGTGTGCAACTGGTTCATCAATGCCCGTCGCCGCATTCTACCGGAGATGATCAGGCGCGAGGGCAACGATCC
          TCTGCACTTCACCATATCGCGACGTGGCAAAAAGGTTAGCCCCAACTGTTCGAGATCAAGTGCGTTGGGCGCAAACTTGA
          CTGGGCCGAATCCCGCACACGGAAGTCCTGCTTCCGAAGTGGTCGTTGGCGCTACAGAGGAGGTGGATGGCGCCGGTGAG
          ATTCACGAGGGCATCGCCAATGTGCTGACCAACTTTGAACAGTATGTGCAGGGCCCCAACGGACAAATGGTCAAGATGGA
          GCCGGAGTACGAGGACAGTGTCATCTACAGCTGGCAGCAGGCCATTGCAAACAACCCGATGGGCTTTCAAAGTCTTCACT
          CCTCGCTTCAAGCAACCATGATCGATAAAATTAAAAACTATCAGATGCGCAAGGCTGCCGCCATTGGGGGTTCGGCGGTT
          GGCTCTGGTGGTGCTGGTGGGTCGAGCTCCAACTCCAGTCCTGCCACATCAATACTGCCATACAGCCTTTTTGGCCAGCT
          GCCGCCAGAGTTCGATGACGAAGAAAAGCCAAGACCTCCGAAGCGCGTAAGAACGCGGACGGTTGCTGCAAAGAGTCCTA
          GGGAGAATGCCAAGCAAGCAAAGCAGAAGACTGGGAATAAGCAAGAAACCATGTACTGCTATAAGGATTCATACGGCGGA
          ATCGTGGTGTCTCCTAGGTCCGAAGGCGAAGAGAGTGCACAGGGATACGAGTCCTGTGGGCCGAACAGCGAGGAGGAAGT
          ACGCTTCGAGACCTCCCATGATTGGCAGAGCGTTATAAAAACTGTATTTGGTACTGAGGAAGTCAGCACTTCGGCTGGCA
          ATAATCCAGGTACCTCTGGTTCTAAGGGATCTGTTCAGAATACCGCCATCTGGAATCGCAATCAGACTGCGAAGCGTGAC
          GTGAATCAACAGTTGACTGACTTTGAAAGCGAGCTGAATAGAATACAGGCCTCAGAAATCCAGACAATCGATCCTACCAA
          CTCCAATCAACAGGACATTGGTGACAATCTACAGGCGGACGAGGTGTTTACCGGTGCCGAAGCAGAAGCTGGCCAGAGTC
          AATTATCTGCTATGTCGCAGGGCACAAGTCCAGATGAGCGTGCCAAGTACAAGTGTCTCTATTATCTAGTGGAAACTGCC
          ATGGCTGTGCGCCAAAACGATGACGTCCAGGATGACGATTTCGTTTACATGGGAGACTAGAGCCTCAAACCAAATACCCA
          CGCTACAGATCCCGACTTCCCAAAGTGCCGAAGCGTGTATATACAAATATGTATATATAGATATATATATATACTTAAGT
          AATTTAATCGAACAGCACTAGACCCAAAAATTTGTCTATAACCCCCATGTTATTGTGTTAATTGAGTAGGTTACTAACAT
          AACGTACAAAGCTATAGATCAATTCGCAATGCGACCGCCCAAATACCTTTTTCCACAAAGTCAATTCACAAACAAATCGA
          CTTAGTTTTGGACCTGACTCTTTTAAACTTAACATGTACACTACTGATACTTAAATAAAACATAAACAAGCATTTGAAAT
          ACACATTGCCATAAAATGATGGTGTGTTTTATCTAATTGGCTGATAGAGCCATTTTTTTAAGGTATCTAGTAATTATGTA
          CACATACATACATAAAATGAGAACGTTTGTGGAAGGACAAAATTAATTTTGTTATAAATATTATAAATGTATTGGAATAC
          TTTGGTTACCACAGATAATAAAGAGTGGCGCAAAAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0087943
          2122
          FBtr0087942
          2509
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0308697
          555
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0087054
          426
          FBpp0087053
          555
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          achi-RD
          Secondary FlyBase IDs
            References (0)