Open Close
General Information
Symbol
Dmel\PAPLA1-RD
Species
D. melanogaster
Annotation Symbol
CG8552-RD
FlyBase ID
FBtr0339673
Feature type
Associated gene
Evidence Rank
Length (nt)
6565
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 48 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CTGGTAAAAGCTTTCCATGGCGAATGGCCAATGCGCGGAAAGAAGCAGAATATTGCCTGCCTGGAAGTTTTCTCGGGTTT
          AACGCTTTTAATCCGTCGTGGGTGTCAATATCCTGTGTATAAAAATAATTCCTAAGGCAACTGTGCACTTGGCACACATC
          TTCATATCGAGTTAGCCCAATTTAAAGCTCCAGATCGGCCGCTAATATGTCGGAAAGATCGAAAGGTGACGTGTCCGCTC
          GCGTAAACAACAACGCAAACCAGACGCGTGTCGTTAAAAATCCGCTTCTGAGCGCCTCCGTGACCGGCCTGAGTTTCGAC
          GACTTCCCCAACAAGCCGCAGCTCCTGCCAGCCGCCCCGCCCGTGGTCCATGCCACGCCTCCAGCGGCGCCCGTCCTCAT
          CGCTGGCATCTTGAATCGCGAACCGAAATCATTGGTCACCGTTGGTCAGCCATCGAGCATTGACGATAGCGAGGCGCTCG
          ACGAGATTAACTTGAATACCAGCAGCGAGGATTCCGTTGGCGCAGGTGGATCGAGTCCATATCTAGGAGCAGGCGATCAA
          AACGCCAATCCTCTGTTGGAACCACCAACGGAAGCTGGAAACGATTCGTTGCTGAGCCAGGCGGCCTCCTCCTTTACTGC
          CCTGCCTGCGGTGGCATCCAATGTGTTTTCCACCTTCTCGAAGCGGATCTACGCCGGCAGCAGGGAGACCTCGGAGGAGC
          CCAAACTAGACATACAGCCCTCTTACATTCAGCAGGCCAGCTACGTTCAGCCAGTAGCTCCAGTGCCAGCTCCCTTTTAT
          GCAGCACCGCCAGCGGCCGCAAACGAAGTGGTCGCCCCCGAACCACCCAAGTTCTACGCACCTACTGAGGTTCCGCCACC
          GAATGTAGGAGTCCCTGCACCACCGCCTACATCGGGAAATCCAAACACATACAGATTCACCGCCAGGAAGAAGCTATACG
          CTCCCATTCCTGGATTATCCGAGCAGTCCGGACAACCTGCACAACAGCCACAGGTTCCTCAGGCTCCCCAAGCGGCTCCA
          TCATTCCAGACGCCACCATATCCACCACAGCTAACGTACGCAGCAAACCCTGCTCCCTTTGACATATCAGCGCAGCCAGC
          TGCAATTCCCGCAGAGGAACGCAAATCTGGTGGAGGACTCTTCTCTTTGACCAGTCTCGTGCCCACAGGAGTGCTTCAAA
          ATATCACAGGAATTGTTCAATCAGCCACTGGGCGAAGCAGTGAACCAGAACACACTAACGTCCAGCAAGCAGGAGGCTAC
          CTAGACATTACAACAGCATCAGCACCAGCTCCATCGACCAACTTATTTGGTGGACCGAATTCAACCTTTCCGCCGGGAGG
          AAATTATTTCGTACCGGGAGCACCTCCATCATTACCCTCAACAGGGGTAGTAGGCCCCCCTTCGGTCGGAAACTTCTTCG
          CGCCGGCTGCTCCATTGCCAGTAGCACAAACAGCTGCTCCACCAGCTGTCGGAGCCTTCTTCACATCTGCTGCCCCAAGT
          GTTACGCCTTCAGTTTTTACTCCAGGAACAGTTCCACCTCTTGCACCGCAGCCTTTTCAGTCAGCAACTGTAAACCAATC
          TGCATTGCCACCAAACAATCCGCCGACCGCATCTGCAGTAGGAGAACTCTTTGTTCCAGCACCAACGACAATCGCCCAAG
          GAACTTCACCTGCAGTTCCATTTGTTGACACACAAGCTGTTCCAACAATACCTTTAACAGTTCCACCAGGCAATCCTCCT
          CCAACATCGACACTTGGAGGATTCTTTACCACAGGTGAAGTTGCACCTGTTGTTGCGCCATTTGGAACACAAGCGTCACC
          AGCAACACAATCTGCAGGATTCTTTAATCCAGGAGAAGTTCGTCCTAATGTCCCGTTAGCCGAACCTGTTCCAACTATAC
          CGATTACATCATCAGGTGTTCCACCTATAGGATTATTTCCTCCAGCACCGGCACAGCCTGGTGTCCAAACTGCTTCAAAT
          CCGAATCCCTTGCCAGGAGCAGCTGCACCGCCACCAGCCGCTGGGCAAGCTTCATATCGTCTCCAGAAGGGAACTCGTCT
          TTACAAGAGTCCATTGACGCCCCAGGAAACCGCAACATCTTCGGGATTCGCCGCTCCTCTGCCCCCCACATCTGTAACTC
          CAGCAATTTTTAATCCATTCGGAGCACCGGCACCAGGATCTTTCAATTCAGTAGGCCATCTAGAGGGTCAATCCAGCCAA
          GGAGTTCCTTTCTTTACGCCGCCAGTGCAGAATCCACCAGGACAAGTAGCGGCTCCAACTGTTGCTGTTCCGCAATCAGC
          ACCTATTGCCCCTCCACCAGGGACATCAAGCACAAGTGTTGCTCCTCCGCTAACAGCATCTATAGCCAATCCTCCTCCAA
          CATCTGGCTTTGCAAGTGTACCCCTCTTCGCTGCACCAACAATATCCTCAACGCCTATTCCTTTCTTCAATCCTCAACCA
          ACAGGAGCAGAAGTAACAACTGGTTTGAGCCAACAGGAAAACGAAGCTACAGCATCGACAACTTTGGAAGGTCTAGTGCA
          AGGACCTGCTCCAACACTCTCTGCAAGTCAATTCTTTGATACGCCCTTGCCAACAGGAACCCAACCGGAGAATCAAGTAG
          CAAGTGTTTCCTCGGAAAGAGAAAATCTTGTACAGGAGCCAATATCGAACCAAGGAATTCCATTCTTTGCGCCGCCGCAA
          ACGAATATTTTTACACCACAGCTTCAGCAAGAGTTCATAGCACCAGCAGAGGATTCCAAGCGATCCGAGATTCAAGAAGA
          ATTCTTATCAGCACCACCACAAGAATCTAATCTATCAACCGAACTTAGAGAAGATACACACACTGGTCCACCCGTAATCG
          AACCCGTTTTGGAAGAAACCCCAGCAAGTAGCTCGGAATCGAGTGTTCCGCCCGCAAGTAAGGTAGATCAAGAAGATATA
          GTCTACCCAGAACCATCTGCGCCGGTGGAACAAGAGATTCCATTATTCGTTCCAGTGCCAGGTTTGCCGGGACTAAGTCA
          GGACATACCACTATATCCACCACCACCAACTGGTTCCACCACTGCCAGCTCGATTTTTGCTGCGCCACCAGTGGCTTCAA
          GTGCTCCACTTTTTGTTCCTGTTCCTGGTCCTCCGTCGGTTTCATCGTTATTTTCCCCCTCTCAAGTGGATTCTACTTCT
          TCGTTATTTGCTCCGCCACCAACATCTGCAAATACAACAATACTAACACCGGCTCCGGATACGACTTCTACGTTGTTTGC
          CAACAACATACCAACAACAACACCATCCATACCAGATATAGTTCCAACTACATCGGCTGAGCTGGTTGACGCACCTCCTG
          GTTTCCAGGGATCATCAGACGACACCGCAACCAATCTATTTCAGGGAAACACCGAAACCCAAACAGTTTTTAGTCCATTT
          GCACAAACTAAGGCTACACCTTTGGTTCAGGAAACAAAACCCGAATTGGTTCCACCTCCAATTGGATTCTTTGCGCCGAA
          AAGCGAGTCGGAAGTTCTTAGCCAGCCACCACTTGCTCCCTCGCCACTGCAAAGCTTCTTCAGCACAGCACCAGAAACAG
          CAACAACCACCGACTTCAATTTCTTCGGAAGCCCAGCACCCGGCAGCGTGTTTCCTGATTTGCCAGTGCAGCAGGGAATC
          GCACCGCCACCATTGGCACTTGAGTCACCGCCACAGAATAGTGTGTCCAATATAGCCACATCTGCTATAGGATTCGATTT
          GTTAAACCAGACTCAGCAAGCTTCAAGTTTAGTCGAAAACTCAAATCAAAATTCAAGTGTCAACTCTTTCGACGGCTATT
          TTGGTGGTCCTAGTGCATCTGCGGCACAAACATTCGCAAACGAGACAACTAATGCACTTGTTGCTCCAGCTATAAACTGC
          GATCCCGTCAATTTCTTCGATCAGGTTCCTCAAACCCAGTCGCAAATCCAGCAAGCAAACGAGGATCAGCGCATTCAGAA
          CTTCTTCAACAATCCACCGTTGCAGGATCAACCCGCTGTACCAGGTGAACTCAAATACGACATTGTCCACAGCGGAGTGG
          CTGTTAAGCAGCTGCAAGAGCGCTCACAGACGCCCGTTTCAAATCTTGTCGAGCCACCTTCGTCTGCCTGTTCGGAATTC
          TCGACCCTTGCTCCAGCACCAACACAAACCGATCGCCAATCGGGCGACGATCTACTCCAACAGCATCTGGGCGAATTGCC
          CGAGGATATCCTCAGAGAGCTTAGAATGGCAAGTGCCAGCAGCGAAAAGGGCCAGGTGGCGACGCCTCCCGTGGCTATAC
          CTTACTCACCAGTGGTGGCCCATTGGTTCTACAAGCGCAGCGTGGACACAAAGTTCATCTGGACACCATTCAGCCACTAT
          GATTCGGCCTTGTTAGAAACCAGCCTAAATCTTGACGATTCCACATTGATTATTCCCGTTGAGGGTGGCCGCTACGATGT
          AAACATCAAGGAACGTACCAAGACTCCCGTTTACTGGGAGGGAAAGGCCATCGAAGTGCGACGCTGCTCCTGGTTCTACA
          AGGGAGTTGACTCCAAGTATGTTCCATACACCGAGGATACGGCTGCACTACTTGAAGCGGAATACAAGCGATCTGCGGAG
          ACTGGTGAATGGCATCAGAAGATTATGCTGGCCAATGGCGAACAGGTGGTCTTCCACGGACCTACAGTCATCGTTCACTT
          CCTGCCGCAACAGAATGCAGACACTTGGGGAGCCAGCACACAGGGTTCCATGCGTCCGAGAGTTGTCAAGAGGGATCTGG
          ATGATTTCACCATCGAGCAAGGCGAATCGCAGCGAGTCGATCACCTGCTTTTCATGGTCCATGGCATTGGCTCAGCCTGC
          GATTTGAAAATGCGTTCCGTGGAGGAAGTGGTGGATGACTTCCGGGTTATTGCCCAGCAACTAGTTCAGTCGCACTACAA
          AAACTCAACAGATATGGGCCTGGTGGGTCGCGTTGAAGTTTTGCCCATCTCGTGGCACGGACACCTGCACTCCGAGGAGT
          TAGGCATCGACGAAAAGCTGAAATCCATCACTTTGGAGTCTATTCCTCGCTTGCGAAACTTCACCAATGACACGCTGCTC
          GACGTGCTGTTCTACACCAGTCCGAAATACTGTCAAAAGATCATGAACACGGTGGCAGATGCGCTTAACGATGTCTACCT
          GAAGTACCGAATGCGGCACCCTGAATTCAATGGGGGAGTTTCGCTGGCAGGTCACAGTCTCGGCTCCCTAATCCTATTCG
          ATTTATTGTGCCATCAGGAACCGCTCAAGGAAAGCGAGGAAGAGAATAAAAATCCCGACCAACTTCCCCAAAAGCAATCG
          AGTCAAAAGGTACAGCTTCCAACCAGCGATCCTTTGCCGAAACAAGTCAGCTATGCGATGGGTCCGGAGGGCACGGGACA
          GCCCGTGATTACATATACACAGCTGATATTCCACCCCAAAAAATTCTTTGCTCTGGGCTCACCCATCGGAATGTTTGTAA
          CCATCAGGGGGATTGATAAGCTTGGTCTCGACTTTCACCTGCCCACGTGTCCGGGTTTCTACAACATATTCCATCCCTTC
          GATCCGGTAGCCTATCGGATCGAGGCGCTTGTCAATCCGGACATGAACGGCATTCGACCGGTGTTAATTCCCCATCACAA
          GGGACGAAAACGAATGCACCTGGAGCTGAAGGAGACGATGACACGTGTGGGTGCGGACATCAAGCAGCGATTTATGGACA
          CATTCAAGACCACGCTGGACAGCGTAAACTTTTTGACCACGGTAACGAAGGTTAAGAAGGAAGCGGAGGAGTCGCTGGAG
          AAGGAGACAAGCCAGACTTCATCGCAAGCTTTTCAAAAGCAAACCGAGGATCAGGACGAGAGTTCAGTTGCCAGTTCATC
          TTGCAAACTACGAAATCGCACCGATTCCAATTCGACGACGGCTTCTGACCCTGAGTTTATAGAACTTGATTTCCCACTGG
          GTAAGCTGAACGACTCAAAACGTGTGGACTACGTGCTTCAGGAAGCTCCACTAGAATTCATCAACGAATATATTTTCGCC
          CTGAGCAGCCATGTGTGCTACTGGGGCTCCGAAGATACGATCCTTTTCGTGATGAAGGAGATTTATGCCAGCCTGGGAAT
          CAGCACAGACAGCCAGGTGCCGCAGTCCTCAATGACCATCGAGCGACCCGTTTCGCATGAGAGCAGTGTTAGCCACTCGC
          TGTTGCCGATGTGAGTCCACAAAACCACACGAGAGCTCTGTTGGATCCAACGATCCCACCCGAATCATGCAAAGAATTTT
          CCATATGTGCAACTCCAACATGGTAAAAGGTATTATCAAAATAAGAAGTCTTTATCGTTTGAGTGACAAAACCGTAGCAA
          GTTCTTGAGCTTTACAAAATTACCTATGTATTGATCGGATTGGCACCCATGAGACCTATTTGTTATTTTTGTAATATCGC
          CTGTGTAACAACTAACTTTGTAACATTTATGTTAAACGAAGTGTATGTCTAACAAATTTTAAAATAAATAACTACCATTG
          TTTTC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0079641
          6570
          FBtr0302595
          6443
          FBtr0344863
          6346
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0308730
          2015
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0079257
          2016
          FBpp0291751
          663
          FBpp0311178
          663
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Transcriptional initiation is supported by short-capped RNA data (FBrf0209722) and RAMPAGE TSS data (FBrf0220331).

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG8552-RD
          PAPLA1-RD
          Secondary FlyBase IDs
            References (0)