Open Close
General Information
Symbol
Dmel\CG1572-RC
Species
D. melanogaster
Annotation Symbol
CG1572-RC
FlyBase ID
FBtr0339693
Feature type
Associated gene
Evidence Rank
Length (nt)
1245
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCAGTTTCGTTTGCAACGTGCGCGCGAAAAGACGCAAAAGTCGAAAGAAAAGTGCGAGGAAAACCAGTTGGCTGAGTCCT
          ACGCCGAATTTTGAGAAAAGTAAGAGTAAGATCCATACCGAAAACTTTAGATATACAGAGAGAGAAAGAGACCCCACCTT
          TAACCCCCCGAAAAGAACCACCGAAGCAGAGCGAAGATGTCGCATTCAGTGACCATTACCCGCACCACCACCAGCACCAC
          CAACACCTCCTACATTGTCCTGAACACGGGCTATCTGAAGACTTTCCCCGGCATCCTCAAGCTCTTCGAGCTGATCATTG
          GTGCTTCCATTGTGGGAATTCTGGCGTTCAACTACCAGGACTACCACAGATACTTCTATGGCCAGCAGGATCTGTTCCAT
          TATCTGATGGCCGTTACCTTTATGATAGGAACGTTCTGTTTACTCCTCGCCTGCCTCACGTCGCTCAGCACGGGCGGCAT
          TATTGCCAAGACGATCTATGAGCTGATTTACCACAGTGTGGCCGCCATCCTGATCCTGGTCTCGTCCACCATCCTGCTGC
          TCAAGCTGCGCGATGTAAAGCACGACGCCTATATGGCAGCCGGTGTTTTGGGCCTGGTCAATGCGGTGCTGTACTTCATC
          AGCGCCTTCCTGGCCCACCGATCCTATCGCGGCATTTAAGCACTAAAGCACCCAAAACCCACCGCCCACTCGGCCATTCA
          AGTGGAATTTGCAATCTCGAAGCATTTGTTCTTCCCACAACCAACTCTAGCCACTGGTCATGCGAAGCAGGAGAAGGAGG
          CGAGAGCCCAGGGATATACAAACATAGATGTAGAGAAAGTGGGTGCCAAGCGGCGGAATCTTTGTTGTACTGTGAAACGT
          TCTTTGGCGCTAGTTACACTTACTTGTACTTTTACCGATATATACAAAACTTTTTTTTTGTCTCACTTTCTTTTGTACCA
          AACAGATTGTCATGTATTCGAATAAAGATGTGTGTCTATATGTTTTTTCTAAATGTGTAGTAGTTTGTTTATTTGTTGCT
          TCAGCTGCAATAGTTTTTTATTGTCGGCATGCTTTAATTGTGTTGGCCAGTGTACTTTGTACTTTTTGATTTTGAACCGA
          TCGTAAAAAGTGTTGCATACTTTTGGGCCATGCGGGAAATGTTGCTGTTAGCAAGCAAATATATAAATTCGATGAAATCA
          TAATTTCATTTAATTTAATACCAAAGAGTAATAGAAAAAACGTGG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0073543
          976
          FBtr0073544
          974
          FBtr0339694
          889
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0308750
          160
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0073388
          160
          FBpp0073389
          160
          FBpp0308751
          160
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG1572-RC
          Secondary FlyBase IDs
            References (0)