Open Close
General Information
Symbol
Dmel\SPR-RB
Species
D. melanogaster
Annotation Symbol
CG16752-RB
FlyBase ID
FBtr0339781
Feature type
Associated gene
Evidence Rank
Length (nt)
3357
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTTGAGCTTTAGCTTTTGACGTATAAAGAAGTGTCTAAAGTATAGTGCAAAGCTAAAATTTTGTCAGATTTACCAAGTG
          CAAGGTGGGAAAATGTTGAAGCCAGTCATAAATTAGGTTTAGTTTTTACAGAGGATACGAAATGAATAATGTTTTTAAAT
          GGAAAAATGTATGGCGTTTTTGAGCAGCAGTACAACTAGCGCCAGCATATAGATCACGGAAAATGCCTGATTTGCGAGCT
          GCAATTGAGAATTAAGGCAGCGCCAGGGGAATCCGCTCGAGAAACCCACGTCCACGAGATGGACAACTATACGGACGTAC
          TGTACCAGTACCGCTTGGCACCGTCCGCCAGCCCGGAAATGGAAATGGAACTGGCCGATCCGCGTCAGATGGTCCGCGGA
          TTTCATCTGCCAACCAACGAGTCGCAGTTGGAGATTCCCGACTATGGCAACGAGAGCCTGGACTATCCCAACTACCAGCA
          GATGGTCGGCGGACCGTGTCGCATGGAGGACAACAATATCAGCTATTGGAATCTCACCTGCGATTCGCCACTGGAGTACG
          CTATGCCGCTCTATGGCTACTGTATGCCCTTCCTGCTGATCATCACCATTATCTCGAACTCCCTGATTGTGCTCGTTTTG
          AGCAAGAAGAGCATGGCCACGCCCACCAATTTTGTGCTAATGGGAATGGCTATATGCGATATGCTGACGGTTATATTTCC
          GGCACCCGGTCTCTGGTATATGTACACATTCGGCAATCATTATAAGCCCCTGCATCCGGTCTCCATGTGTCTGGCCTACA
          GCATTTTCAATGAGATAATGCCAGCCATGTGCCACACCATCTCCGTTTGGCTAACTCTGGCCCTCGCCGTTCAAAGATAC
          ATCTACGTTTGCCACGCCCCCATGGCCCGAACGTGGTGCACGATGCCGCGTGTGAGGCGGTGCACGGCGTATATTGCATT
          GCTGGCGTTTCTGCACCAACTGCCCAGATTCTTCGACAGGACGTACATGCCGCTGGTGATCGAGTGGAACGGCAGCCCAA
          CGGAGGTGTGCCACTTGGAGACGTCGATGTGGGTGCACGATTACATTGGAGTGGACCTATACTACACAAGCTACTATCTG
          TTCCGGGTGCTGTTCGTCCACCTGCTGCCCTGCATTATCCTGGTTACCCTGAACATTCTGCTGTTCGCGGCGATGCGGCA
          GGCACAGGAGCGCCGAAAGCTCCTCTTCCGGGAGAACCGGAAGAAGGAGTGCAAGAAACTGAGGGAGACCAATTGCACCA
          CGCTGATGCTAATTGTGGTCGTGTCGGTGTTCCTTCTAGCCGAGATACCCATTGCTGTGGTCACTGCGATGCACATCGTC
          AGTAGCCTGATTATCGAGTTCCTGGACTATGGACTGGCCAACATTTGCATCATGCTGACGAACTTCTTCCTGGTATTCAG
          CTATCCGATCAACTTCGGCATTTACTGCGGCATGTCGCGCCAGTTTCGGGAGACTTTCAAGGAGATATTCCTCGGTCGGC
          TGATGGCCAAAAAGGATAGCTCCACAAAATACTCGATCGTTAATGGCGCCCGCACCTGCACCAACACCAACGAGACGGTC
          CTCTAGTAATTGGTGATGTTGGTGCCGCGGCGGGGCAGCAGCGACCATCGTCGCAGCTCCACTAGCACCACCACCACCAC
          CACCACCAAGACCATTGGTGGGTCAATGATCATCGGTGGTGAGGCCTCGGCGCAGCACCAGCATCTGGTAACGCACCATC
          TGCAGACCCACTCACAGCCCAGTCAGCAGCGGCGGGTCAGCACCATGGACATCATCACCGAGGAGCGGATTTTGTAAACT
          GGATGCGAGAATCGGATGGGTTCGGAATCGATTGGGTGCGGCTATCGGAAATCAGAGATCCCAATATACTGTTGAAAACT
          ATCGGCTGCCTGCCGAGGAGCGCAATTTACAATACAGTTCTTTATTCGTCAATGGTCTCAGCATGAAATTTTAACAGAAT
          TTGCAATTGCAACTAATCCAGCAAAAATCAAAAGAACTCCACTACACAAATGGTTTTTTTTCGAACAGAGCTAAGAAGTA
          AGGTTTCAGGAGAAAACTACAATACATAGGTACACAGGAACTTGTTTAATTAAAAACACTAATATATCAATATCAAAATA
          ACCAAAAATGCGTAGAGTATTTGGAATGATGCAGTCTGAATTTTGATGGATTTTGCAAATGAGCGATTTTCACTTTTAAA
          TAACTTAAGGCAGTTTAAAAACGTTAAGAAATACATAGATATCCCCGGGTAGACCGAATAACACCCAAACCGAACATTAA
          GTGTCTGTTCTATTCCCGCGAATAAGACACAAATTTCTCCATTCGAATCTGTGTGTATTTCTCTGTGCGTTGGTGTCATA
          TTCAGATTAAATATTCAGATTAGTACTTAAGCTCATATATGTATATGCTATTTTTATGGCTAAGGGTGTACGTCTAAGTC
          TAAGAGATGCGGTGAAACTTTCAAGAAGTGATAGTGGTAGGGTGAAAGTGCTGGGTGAAGATTTTGGGTAACAACAATAA
          CATAATACTACAGTAAAGTTAGGAAAAATACTTACAGGAAACTCACAAGTCATAACTATCGGATTGAAAAGCGAAACTGA
          ATTAATCGAAATAATCGATAGTATTGACGATTAGTTTTAGCTTCTAGGGTATTTACGAAATTTTGAAACAATGCCTGGGT
          AAATATGTTTATTTGAGAGCAACTTTTTGTGCGCCCATTTGTAAAATATTTTTGTATTTTAACTAGGGTTCTTTAGCGTA
          GTTAGTTGTAGGATGGAAAACTCGTTTAAATTCGTAAACCTTTTGAGCCCCAGTGTTTACCGATTTAAATGAAAGTTAAG
          AATACACAAAAACAAAAAAAAAAAAAATATATAAGAACATAACAAATCAGTCCTAACGAATTTCAACTCAATGTTCTAGG
          CTACGCGTACGTTTTTTTTCTAGTGTAAGCAACAGCATATACAATTGTAATGCAATGTTAATATGTGTACACTCGTCTAA
          CAGTTACAATTGCAGTTTCCGGTTTAAATGTTTTCAGTGTACACAAAACTAGTTGACTAAGCATACAACTACGGCTAAAG
          CTAATACTACAACTTGAATTACAACTACACAACTATGAACTATAACCATAACTATAGCTGAAAGTTGTCTGTCTGAATGG
          AATGTGTTAACTATTTATATGTATTGGTGACGAAAGATACGGTTTCCGTTTCCGCTTCCGTTTAATTTGATTTTTAATTC
          TGATGACGATTACGACCTGATTTTGTATATATATTTCGTCGGGTGAATCCAATAATGAATAAATAAACTAATTAAAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0070778
          3093
          FBtr0344824
          2804
          FBtr0479797
          3093
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0308828
          435
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0070744
          435
          FBpp0311140
          435
          FBpp0428130
          512
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          SPR-RB
          Secondary FlyBase IDs
            References (0)