Open Close
General Information
Symbol
Dmel\CG4678-RK
Species
D. melanogaster
Annotation Symbol
CG4678-RK
FlyBase ID
FBtr0339828
Feature type
Associated gene
Evidence Rank
Length (nt)
1670
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCAGTCGAACTTAAACGGCGCTGGCAATCGGACGCGTTTTCGAAAACTCGCTCTCTCTGCGATTTCATTCTGGTTTTTTG
          GGAAAGTAAAAAAAGGTGCGAAGAACAACGAGAACAACAACAACAACAACAACATCAACGGCAGCTGCAAGAATAATAAT
          AGAAATTGCTGTCGAGCAGAAAACTGGAAATCCAAAGGCAGCAGCAAGAAATCAGAGCCACCAGTGCGAGGTACCCCAAT
          CTCACTGCCTTGTACTCCATCGGAAAATCCATCCAGGGACGTGATCTTTGGGTAATGGTGGTCAGCTCGTCGCCATATGA
          GCACATGGTGGGTAAGCCGGATGTGAAGTACGTGGGCAATATCCACGGAAACGAGCCAGTCGGCCGGGAGATGCTGCTCC
          ACCTCATCCAGTATTTCGTGACCAGCTACAACACGGATCAGTACGTCAAATGGCTGCTGGACAACACACGGATTCACATT
          CTGCCCACAATGAATCCGGATGGTTATGCGGTTTCCAAGGAGGGCACATGCGATGGTGGCCAAGGAAGATATAATGCCCG
          TGGATTCGATCTGAATCGCAACTTTCCCGACTATTTCAAGCAGAACAACAAACGGGGTCAGCCAGAAACGGATTCGGTAA
          AGGATTGGATATCCAAGATTCAGTTCGTGCTCAGTGGAAGCCTGCATGGTGGTGCCCTGGTGGCCAGTTATCCGTACGAC
          AATACGCCGAACTCCATGTTCCAGACCTACTCGGCGGCGCCATCGCTGACGCCCGACGATGATGTGTTCAAGCACCTGTC
          CCTGGTCTATGCCCGCAACCATGCCAAGATGTCCAGGGGCGTCGCCTGCAAGTCAGCGACGCCGGCCTTCGAGAACGGCA
          TCACCAACGGAGCCGCCTGGTATCCACTGACCGGCGGAATGCAGGACTACAACTATGTGTGGTACGGCTGCATGGAGATT
          ACGCTGGAGATATCCTGCTGCAAGTTTCCGCCAGCCTACGAGCTCAAGAAGTACTGGGAGGACAATCAGCTGTCACTTAT
          CAAATTCCTGGCCGAGGCGCATCGCGGTGTCCAGGGATTCGTGTTCGATCCGGCGGGCATGCCCATTGAGCGAGCCTCCA
          TCAAGATCAAGGGACGCGATGTGGGTTTCCAGACCACCAAGTACGGCGAGTTCTGGCGCATACTTCTGCCGGGCTACTAC
          AAAGTGGAGGTCTTTGCCGAGGGCTTCGCTCCTCGCGAGGTGGAGTTCGTGATCGTGGAGCAGCATCCCACGCTGCTCAA
          TGTAACGCTGCAGCCCTCAAAGCGCTTGGAGGGCATTGGGCCCATGGGTCCCGGCGGAGTGCCAGTGGGTGGTGTAGTGG
          GTCCCGGTGGGCTATACCGCCCCATTCCGTCGCCGCAGCATTACCGCCCACCTGTACCGCCCTACGCGGGCGCCGCCTCC
          AGCGATAGTGGCATATTCTCGACCATCAGCAATGGTTTAAACAGCCTGTACTCAAATATATTCGGCTAAGGAACGGCGAT
          TTCGAGGATCTTCATTAAGGATTTTTTTATTTTCTTTTAAGCATGCCTAGAACTTAAGTTACAACCTTCGACGTACTATT
          TATTGTGAACAGGAAGAGATGGGAATGGATAGACCCAAATAAAGCGTTCAACCAGTGCAATCTATTCTAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0300032
          2007
          FBtr0300033
          1994
          FBtr0300034
          1875
          FBtr0300035
          1902
          FBtr0308847
          1952
          FBtr0339827
          1982
          FBtr0339829
          2062
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0308862
          404
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0289309
          518
          FBpp0289310
          527
          FBpp0289311
          479
          FBpp0289312
          488
          FBpp0301002
          513
          FBpp0308861
          523
          FBpp0308863
          474
          Comments

          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG4678-RK
          Secondary FlyBase IDs
            References (0)