Open Close
General Information
Symbol
Dmel\CG42258-RE
Species
D. melanogaster
Annotation Symbol
CG42258-RE
FlyBase ID
FBtr0339839
Feature type
Associated gene
Evidence Rank
Length (nt)
1648
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 43 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CGCCGTAAATCTGTATAACTCCTGGATGAAAAGTGCCATTTTGGACGCGGAAAAGCAGATTATTCAGTAATCGGAGCGTT
        CGATAGTGCGCGTTTCAATCTACAACAGCAGCCAGCCGCAAGTAATCTGTCCACCGGCGGAGTATCTGGACTTTCCGGAG
        TTCAACTACAGCAGCAACCTCTTAGACTATAATACGATGGCCACGACGGCGGCGGGGATCCAACAGCAGCAGGTGATTGG
        CCTGGGAGCGGCATACGATCGACAGCAAAGCACCGATTCCGGCTGGGACAATCCCTTTCGACCAGGCGGCGATCTGTCCA
        GAGAGGCTGATGAAATTGTCAATATGATCAGAGGTGGCAAGCCCATCACACCCACAGAGGAGCGTACAATTGGCAACGGG
        AGCGCCCAGCATGCGGACGACAATTGCAACGGCGGTACGGCGATCGGCGAGAGTGTAATCAAATCAAATGGTCTATGTCA
        TTTGCAGCTCTCGCAGAATCTAGCAACAGCACAAAATGGTACAAATTCCCATGCCTCTGCAACTGCCGACGCTGGCGCCG
        GAAAAGCAGCGACGGCGACCGAGCTGAGCGGCGGAACCGGAAACAATGGGGTCACCTCGCTGGGACAGGTGTCCAAACAG
        GTGGTTCCCGGACCGACGTCCGCTAGTCATGTGGTCATCGACGAGAAGAAGAACAAGAAGAAGGGCTGCTGTGTCCTTCA
        ATAATTGGGGCAAATAGCGGGGGACGCGATGAGCAGATTTGTGGGGTAGGGGGGGAGGGGCGGTCATTTTCCTGCTAGCC
        CTGTTTTTTGATGTTAATGTTTTTTTGGACGAAATGGAGCCAAGCTGTTAATATATTTCATGCCGCATAAATCGCTTTGC
        TTCGCTTTGCAAGAGGAGACCAAAACCGATACCAGAGATTGAGATTCAGACAACACAAGAATGAACTAGAGGAACATTAG
        GAAAACCAAGCTCTCTGACCAACAGCAGCCACAGTGAGAACCAACATTTATGCAACACCCTGCAGCGGTTGCTCCAGCTT
        CGAAACATAAGTCGATGAACACTTCAACATTTGAATTGTAAACCTGAAGGCCGCACTTATATATGTTTATATATATATAT
        ATTTATATATATATATGATATATATATATCTGTTTGTCTGCAGGCGATGCTATATTGCAATTCACCATTATTATATATAT
        ATATATATTATTTTTTTCCCCCTTTTTCTGTAATGTGACTCGACCTGCATATGTGTATTATAAAAATTATTGTATGCATA
        TATGTGAATTTATTTTTTTTTTTTTTGTAATTGTAAAATTTAGTGCGGCTTTTTTAAAAAATGAAAAGGATGTAGGGACG
        TTTAACAAGTAAAAACTAAAAGAACAAAAAAATAACGAAAAACGTTTTGCTTGCATGCATAATGGATACAAAATCGAAAA
        AAAAAATTTAACATAAAGAATAATGTATTTATTTTTATTTATATGATGACGATGAAGCAGATGAAAGTAAATTAAATGTT
        AAACCTTAAAACAAATATACACACACACACACGTACATATACAAATACACACACACACATACGCATATATACTATACGAT
        ATATGAGATGAAATGAATGACGCAATAAAGCAAAACGAGATGAACCGG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0299558
        3827
        FBtr0299559
        1806
        FBtr0339840
        2740
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0308871
        175
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0288833
        465
        FBpp0288834
        169
        FBpp0308872
        169
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG42258-RE
        Secondary FlyBase IDs
          References (0)