Open Close
General Information
Symbol
Dmel\Idgf6-RB
Species
D. melanogaster
Annotation Symbol
CG5210-RB
FlyBase ID
FBtr0340066
Feature type
Associated gene
Evidence Rank
Length (nt)
1811
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 291 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GGGGGAAACAAAGAAGAGACTGGAAACGAGAAGCCCAGGCTTAGGGTTCAGAACAAAAACCCCAAATCGAGGTCGGGAAT
      TGATAACAGCGGAGCAGCTGTAGCCTAAAAGCTCGAATTTGGCGATGCCGAGGCACAAAAAATTCATGAGCAGCAGCAAA
      CAAGAAAAGAAAACAAACCAAAGATAACAACAAAAAAAAAAAAAAACAAGAACAACAATGACGACCACGTCTCAACCTTC
      GACAAGCTGGGATGCGAAGTAAAGCCCCAGTTTCAGTTCCAAGTCGACACTTGAGCGGCGCACAACTCAACGGTATCAAG
      TGAAATCCGCGAATCAAAGATGATCATTAAAGCCCTAGCGATCGTTTCGCTGTGCCTGGCCAGCATTCAGGCCTCCAAGG
      TGGGAGCTCCGCAGTTGCCCAAGAAGCACCTGGTCTGCTACTACGATTCCGCCAGTTTCGTCAAGGAAGGTCTGGGCAAG
      CTGGTAATCGATGAACTGGAACCGGCTCTGCAATTCTGCGACTATCTGGTCTACGGCTATGCCGGAATCGAGCGCGATTC
      GCACAAGGCGGTGAGTCTGAACCAGCAGTTGGATTTGGATTTGGGCAAGGGACTTTACCGCACGGTGACCCGCTTGAAGC
      GCAAGTATCCCAATGTCAAGATCCTGCTGAGTGTGGGTGGTGACAAGGACATTGAGCTGGACAAGGATGCCAAGGAGCTG
      CCCAACAAGTATCTCGAACTGCTCGAGAGCCCCACAGGTCGCACTCGTTTCGTGAATACCGTCTACTCGCTGGTAAAGAC
      CTACGGATTCGATGGCTTGGATGTCGCCTGGCAGTTCCCCAAGAATAAGCCGAAGAAGGTGCACAGTGGAATTGGCAGCC
      TGTGGAAGGGCTTCAAGAAGGTCTTCTCCGGCGACTCGATCGTCGATGAGAAGTCCGAGGAGCACAAGGAGCAGTTCACC
      GCTCTACTCCGTGATGTTAAGAACGCCTTCCGTCCGGACAACCTGCTGCTCTCCACCACTGTTCTGCCCAATGTGAACTC
      ATCCCTGTTCTACGACATTCCCGCTGTGGTCAACTATTTAGACTTTGTGAATCTGGGTACCTTCGATTTCTTTACACCCC
      AGCGTAATCCCGAAGTTGCCGACTATGCCGCACCCATTTATGAACTGAGCGAACGCAATCCCGAGTTCAATGTGGCTGCT
      CAGGTGAAGTACTGGTTGCGCAACAACTGTCCCGCCAGCAAGATCAATGTGGGCGTGGCCACCTACGGTCGCCCATGGAA
      ACTGACCGATGACTCTGGCGACACTGGTGTTCCGCCGGTGAAGGACGTCAAGGACGAGGCTCCAGTGGGTGGTAACACTC
      AGGTGCCTGGCATTTACAGCTGGCCGGAGGTCTGCGCCCTGCTGCCCAACCAGAACAACGCCTATTTGAAGGGCGCCAAT
      GCTCCGCTGATCAAGGTTCAGGATCCTGCCAAGCGTTTCGGCTCTTATGCCTACAGGGCAGCCGATAAAAAGGGCGACAA
      TGGCATCTGGGTGAGCTTCGAGGATCCCGATACTGCCGCCGATAAGGCCGGCTATGTGCGCACTGAAAATCTGGGTGGAG
      TCGCGCTATTCGACCTGTCCTACGATGATTTCCGAGGACTCTGCACCAACGAGAAGTACCCCATCCTGAGGGCCATTAAG
      TATCGTCTGACCAACTAAAGTGGGAGTCCAATTTGATTTATGTATAGCTGACCATGTGAAGAAAATGCTTGATCAAGAAA
      TATATTTGTCCCATTTATATTTGTAATGTCATAAAGTGCCTCAGAACACAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0087111
      1541
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0309072
      452
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0086257
      452
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG5210-RB
      Idgf6-RB
      Secondary FlyBase IDs
        References (0)