Open Close
General Information
Symbol
Dmel\tweek-RJ
Species
D. melanogaster
Annotation Symbol
CG42555-RJ
FlyBase ID
FBtr0340172
Feature type
Associated gene
Evidence Rank
Length (nt)
16454
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 7 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGCTGTTCGCGAAGAAGAAGAAACGATGGGAGTGTTTTCGTCCGAGGCGAAATTATTTTTATTTTTTTCGCGCTTCATAG
          CCAGCGATTAATGAGCTAATCTAGCTTAAAACGCGACCGGGTAGTTGCAACTCTTGCTGTGATAAAAGGCAGTGAGCTGC
          CTCGATGAGAAGGCGAGAAAAAACGAATCGAAAATTGAGACACCCGCGACCTCCGAAACAAAGTGGGAAAAATCGAACCT
          GTGTGCGTGTGTGTGTGTCTGCGTTCATTAAAAGTGTGTGTGTAGAATAGTAAATTTAATTTAAAATTAAAGAGCCCAAT
          GTGTGCAATCCATAATCGAATCATATACACAACCTGCGATCGGTGATAATGAGCGCGGCGATGAGCAATCGCTAATCGCG
          AGTGCAAAACCTGAGTAGCAGCAGCAACAACAGCAACATCAACAAACGCAGCAGGCGAATCCAGCACACACCGCACCGCC
          CCGCCCCGCTTACATACACACAGAGAAGCGGCGATGGAGGCGTTGGAAGTGGAGGACACCAGCGATGACAGCCTGCCCAT
          GGGATTCCCAGAAGTGGGCACCTGGAACAGCACCCATAATGTCTCCTTGAACGACATGAATCTGGATGCGCGCATGATAT
          GGTTGCTTGCGTCGCTCCTGACCACGATCACCTGGGTGACGTATATCACCTTTTACAATTCTCGTGTGATTGGCATGCTG
          ATAACGAAGATCGCCAACCGTTGGTTCATCAAGGGCGCGTACTTCAAGATCGGTTCTGTTGCTCTAAATCCGCTGGCAGG
          AAAGATAATGTTCCGAGACTTCGTGTACATCACGTATGACTACACAGTGCGAGCGCAGGATGGATACTTCATATTCCGCT
          GGTGGCGCTCCTATGTACCCAAGGATGTCTCAGAAGATCTTTCCCACTCGGACACGCGCCTATCGGTCCAGCTAAATGGC
          TACGAGCTGCACATATACAACAGATCGGATTTGTACGACACGCTGGAAAAGACGTTTGGTCTGGAACCATCGCTGCTTAT
          ACCGACAGATGCGGCTAGCAATGAGGAGAGAAACAAGCTGAAGGAGCATCATATGAACCTGGAGAATGCACGGCAGAGCC
          AGAGGATTCAGAATGTGAAAAACTCGGAGGCTATGCAGGCCACAACCTGGCGGGATTTAATACCAGTGATAAAAATTGAC
          GTTTGCTCCGGTCGCTTTGTGTTTGGAAACCGATTAACGCCGACTACACTATCGATTTCCGTGGAAGAGGCCCATTGCAC
          CTACAGTACAAAGCCAGCTGTCTGTAGATTGGATCACTTTATGCACTTTGTGAAGGCTAAAGTCGAAAATGCGAAAGTGC
          TCTTCTGTCCGAGTCCCAAGTATACTGGTTTGATTGATGAACCACCGCGATATATGGGCGAAGGCTTTGTGGTGATGATG
          TCCAATCAAATGGATTTGTACTTCTACATGGACGAGCCAGGCGTTGTGCCGGAACATCCTGTACAGATTGTCCTGCCCAA
          CGGTGATGTTGTGGAGCCTTCGCCTCCGGTCTGGGGCATAAATGCCAGGTGTCTCAGAGGCACCGATTTCAGCTACGGAC
          CGTGGGCAGATCGGCAAAGAGATCATTTGTACAGGTACTTTTATCCTTCTGACTGGAAGGAGGCAGAAGTTACACCCACA
          CCCCAGCCAGGGGAACTTCGCAGCTATCAATCCTTCGATGTGACATTGTGCGTGCTAAATGAGGCAACTATTGACATACT
          CTTTTCCAAAGAAAAAGAGACGAATGCAATGCACATTACCGTGGGACCTGCTTCGTATGTAGAGATGACAATTCCCTGGG
          TCACTCAACCGGATGGTTACACATCGAAGATCCAGGGACAGCTCTTCCACGTGGAGGCCACCACATCGCTGCAGTATCGC
          AGCCTGGCAGAGTTCGAGTCCTTGGAGTACAAGGTGCGCATACACTACCCGACCAAGTGGAACGCACCGCAGGATTGGAG
          CATATCTCTCTCCGGCTGCAAGACGAGTGCTTTCATCGTGTACAAACACAAGTGCTTCTTCCAGGATCTCATCGAGGATT
          GGGCTAACAAGGCCAGGCCGGATATACTCAGTTTTGTTCCGTATACCTGTAACTTTAGCATCCGCCTGCATGAGTTCGAA
          ATCCTAATGCTGTGCAACGAGTACAATTGGATCGATTGCAGTAGTGCCAACCAGGAGAACAATCATTTGGCTTTCTGTGG
          AGACGTCTTTGAGATGAGTTTCGCCCTGCCATTTGACGATTTCCTGCCCAAGACAGTTACGCTAAAGTTTTGGATCCACG
          GAGAGGGTTTGGATTTGAGCTTATACGTACCGGAAGTGTCCTCGGTGCGTCCTATTGTTTTAGCCATAGATGAGAACGCA
          AGACTGCTGACCAGGGAGGGCAAGCTCATCCGGCGCCCAGAGTTGTACTCGAAGAAGTGGCGCAAGATTTGCCAGCGCTC
          TGCCGGTTGGATCGACTGTTGGGCAGTGCCCATTCTGGCACTGTCAATTCAGTATGTTTATCATCCAGTTCCACCACTAG
          GACCTGATCCTCAAGCGGATATAACTACGCCAGAAAAAGAAGAGATCTTACTGAGTCCTATGAGGATTCCAAAAGTGAGA
          AAATCACCTGTTAGTAGCTGGCAGCAGCCACCTGAACAGTATAGTAAATTTGATCCTGGAACGCTGGCCGCGGACCACGT
          TACTGTGGAACTGGAGATTGGAAGCTCCGTGCTTATGGCTTATGGAAATGTGCTGCGCAACTTTATTAGCCTGAAGGAAA
          ATATTTTCGGCGAGGATCAGAATTTCACAGACATGGAGCAATCGAATGTAAATATGAAGGAGCCCGGCGTTGCCCAAGTA
          AATCCCAAGGACCAACTGCTGGCCAAAGAAAAGGAGCTGGCCAATAAATCCATTTCAGAGACTCAACCGCCCGAGGAAAA
          GCGCAAACCCTTCGATCCTCGTCTTTACCGTCCTCTTGAGGTGATGGTTTCCGTGATTGTACACGACATTCAGGCGCACG
          TAATGAAGAATTGCAATGAAGATGATCCGCCCTGTCCGGTCGTTCTAATAGAAAGATTCGGCTTCGAAATGAATAAGAAG
          TATCATGAAACCACTCTGCAAGTGTTAGTAAGTCCGTCGTATTTACTTACCTCGGATTGCCTGCAGCGATCGCAGAGGGA
          GCAGCATATTAACCAGGGTCACCTCATGCTCTCCGCAGTCCAGGTTAGAGGTCATGCCATGTTCAGTAATGAGGGCTGTG
          CTCTGGACGAGGACACTCTAGAATATTCCTGGCTCGTGGAGGTTCAGCTGGGCAAACTCACCGGAAAGCTTACTCTACCA
          CAGCTTGTAAACGTCGTTACAGGTCTGGAGACACTTATACTCTTGGCCATTGATCCGGAGAACTGTTTAAAGTCACCTAA
          GACAGTAAGAAACTGCCATCACGGAGTGCCCAGCAATCTGTGCCCCCAAACCAAGGAAGAGAAGAAATACAAGTGTCCGT
          CATCCGAGGATATAAAATACAAAATGACGCGCGTTTCGGTGGATGCTGTGGATGTATATCTGATAGAAAGTGGCACCGCT
          TTGCATGCCTGGATCTCTCCTATTCGTTTGGCAAATTGTAATCTACACGGCCAGCGGGTAAAGTCAGGGATCTCTGGGCT
          ACTGCCCTCCATTCTATTGCGTTTGTTTATGCTCCACACGACAAACTCGACATTCAACACCAACACCACGGGCAGTAATC
          GTTCTGGCAAGCTGAGACGAGCTGATCAGGATTCCCTAAAGTCTCAGGATGCAGGAGGATCTCATTACGCTTCACATGGA
          AAGACCGGAAAGCGAAGCTCCAACTCCTTCTCACGGCGAGATTCTCGGGAGGAGGCCACGCGGAAGCTTAGGGGAAGTTT
          CTCGGAAACGCATACCAAACGTACACCAGAAACAGAGATAACTGAAAATTGGGTGGAGGTGGGCTGCACTTCGCTGGGGC
          CTATTTTGTTGGAGGGAGCGTCGGCTCTACCCATTCCGGATCACGAACTGCATCTCGTGCAGCACAATTTTCTGCGTGAG
          CACGATGCCAAATTCAAGCGACTTTGGTTCCTTTGGTCGAATAACGGAAGTGCATTGTCCTCGGGCAGTGAGATCTCGCG
          TTGTGGCTGTATTGGTGGATGTGCCTTTTTCGGAAGCAATCGAAATGGACAAAAATTCTTTAAGCCAACGGCGCAGGATG
          CCCACGATAACTACAATATAGCGCGATACTTCATTATTAACAACAATAAGGACTTTGGTTTCGGCGAAAGCATTCTGCAC
          CAGGGTCAACTTGTCTTCCACACCCCGCCCTACAGTCTTCATTGTGTTTCGCTGTACGATACAGCGGATTTTAATGGCAA
          AGGCCGCCTGTACAGACCAGCAGGAGATCTGCGAAACGGAAGTCTGAAGAAGACGGATCTCTGCTCTCTGCCAGATGGCA
          CTAAGTTTAAGATCGGTGCAAGTGGTACCACTGGAGTTGAGAAACCTGAGCCCAACTGCCGAAATAAGTCTCGAGAGAGC
          ATTGGATCCCCGAATACGTTGGAAAGGAGGACCAAGCGCTATCCATGTACGAGACAAACTTCCGTGGATGTACCCTATGC
          CCGCCTGCTCGATAGTCCCTCCAAAAAGCTACAGCTGCAGCACGAGGCGTCTGCTGGCGATGCGGGAAGTAGCCATCGAC
          GCGGTTCCGATTCCAATAGGCTGCGGGTTTCACCACCTAAGACTAGCATTTCCGACTCCAGACTGACGGGCGATGTCCTC
          GATGATGAAACAGAGATACCGGATGAAATGTCGCACTCGGCACCTCATTCACATCCGTTGGAATTCGAAATAGCCGATAT
          TGCGCTTCACGTCCAGGGACTAGGTGGAGATCAGTTGCCACGCGAAGTGCAACGCACTATATCGCTGACGTCGGAGAATC
          CCTCAGAGATGTTCTTCTCTGCCGAAGAAGATATATCCAATGTGCTGTCTCAGCGGGGATCCATGAAGCAGCGAAACAGT
          GTAAACAGTGGATCCGTGGTGCTGTCCGGAAAGAAGAGATTCTCATCGGATCTAAGCATTGGAGCTCAAAACGATAATGG
          AAGTCACACATTACCCACATATCGCAGCGATCTAGAGATCCACGCTCCCGACGGCAACAAAACACTTCCAAAAAGGCCGC
          AGAGCACAACAGAACTGAACGAAGACGCGAGACGCATTCACGGTCTTGCCACACCAATAAGAAAAATAACAAATATCTCA
          TCTCGACCTGAGTACCGACATTTTGTTCATGATGCTGATTCTCGTGGCTCATCATCTGGCACCCCATCACTGTCTTCCAA
          CTCTTTCATATCGGCCATGTCTTCACAAGAGGATGTGGCATTGGTTAATCTGCACCAGCAGGTCAACCGGCCAATTATCG
          ACTCACCTTTGCTGATGGCCAGCTACCTAAATCATTTGTCGCAGGTGAAGTGCTTTAACTGGAATGGATGCTCCTTTCCC
          TTGGGTCCAGATGTCTTCTCTACTCCACTCTTCTCGGAGAACGAAGACGGTGGATTGACCTATATTGGCAGCAAGATGCT
          GCCCCACTTTGATCTCTACTCTTGTTGGCGGGAGATTAAAGTGGTTCCTCGATACGAAAACGCCACTGGGAGCAACAGCT
          CGGCTACATTTATGGGTGGACCGAAGTCTCATCCCTGGGACCCCAGTGTGCTCTTGAAAGAGGAGGAATCGGACAAGACC
          ACGAACGGATTTGATGATGGCGAGTTCATGAGTCTGCAGGCTGAGGGAGGAGCGGTCTGTACGTCGGTGGTGGCCAGGCT
          AAAAGGTCAACTGAATGTCTTCCTTACACCGCTTCTACTGGAGGGATTACAAAGAATGGTGGAGGCCGCCGTCCCGACAA
          TTCAATCAATGCACCTGCTCTCGGTGGTAAACTTCATCCACACGTCCTGCATCGCCAAGGTGAACAACGACAATATCCTG
          AAACGGGATCAGAGCTTGAGCTACTGGTCGCAGGTTCACTCGAACTCGAAGCGATCCACGACGGAGAGGCATCTGCAGGG
          ACCCGGGGACTCGTTTCTCAGCGATGTCTATGAGGAGAGTATTTCCACCAAAACACAGGGATTGATTGTCCTGCCCAAAG
          TCAGCATCACCATGCTGCAGTCCTCCATTGTGGAGGAGATTATCTCAGTAGCTGCCTTGGATAATGTACAAGATCTAAGC
          TGCGTGTCGCTGCTCACCTTCTACATGGAGGGCATCTCCACGAAGTTCCACATGGGCAAGACGACGCGTGCCTCCATGCA
          CAACGTCTATATCCAGCAAACGGTCCAATCGGGCAGCAGTAACAAAAAGGGTGGCATCATGAAGGGCACACGTGCTCTCT
          TGGCACATCTTTCCTCACAGACGCGGCCGGACAATGTGCAAGGAGAGCCCATTCTTATCGAGACATCGGAGAAGCAGTTG
          GAGGAGGTGGTCATAACGCTCGATATTGGGAGAGCGCATGCTCAACTGCGACGCCTGAAGACAGAGGGACAGTCTTGCAC
          CCAGGACTCGCCCATCATTGTCACTGCCATTCCAGAACACAAAAGCAAAGTGCTGTTTGAATGCCTGAAAATGCCGGAGA
          GCACGGGCATCGAAAGCATTGGCTACATTATGTTCGAGTGTGGTTTGGAGGGCGTGGGTGTCAAGATAGTCAAGCGATCG
          CACTTTGAAAAGTCCGAGAACAGCAAGGAGGAGTTGGCCGAAATGGCGGGAGCTGGTGCAGGCGGCGGAGCCTCCGCGGG
          TGGTTTCAATCTCAATGATTTGGTGGGCCAAGGAGAAGGAGCCGCGGGCTCTGGCGATGGAGGAGCCACATCAAAAGCTG
          AAGCTGCATGGAGGTTGATAACAAAGAAACCGCCTACACCCAAAACTCCGAAGGAGAAGTTTCAACCTGCTTCAGATAGC
          AACATTTCGGCAGAAACCTCTGGAGCTGAAAAGGGAAAATCCACACCCAAACCTCCAGATGAAGATGTGGAAAAGGGAAC
          AAGCCCAGCGAATGCTCAGACTGGAGCACAGAAACCATCTGCAGGCGCGGGAACCAACACCAAGGATAACTACGACAAGG
          TTTTGTCCAATGTCAAGGAGACGGACAAGACTTCCTCGTGCGTGATTGAACTAAAAGCGGTTTGGTTCAACTTTGCCGCT
          CCACCTTGCGTGCCTATTACCCGAAAGATTGATCTGACGCGATTGGACTGGAATCTTTTGAGCACTGCCTCCCCGGCTAT
          CACCGCATGGATGAACCCCAGTAATCGACTGGCCATGAAAATAGTATCATTGATGAAGGCTCTGCACACGAGACAAACGG
          CAGTGGCTGCTTGTCTTATGGCTGAGGCCATGGATAACGAGAAGATTCAGAGAAATCCCAAGATCAAGAAGAGTCGGTAC
          GCCAATAATTACACGTTGCTGTCGAAGACGCTGCAGGAGGATCCCAGTTGCCAGCTGTGCTACATAATGCAGAAGTTGGT
          TCTGGATGAGGGCGTTCAGAGGATAGAGACGATATTCAAGCAACACGATGTTCCACATCTGAACACCCTAAGACAGGGAA
          TCATTGTGCTAAGCCGGCAGTGGAAGAATACGCTGTACAATCCAATTCTGTTTGAGCATCAGTACAAGAACAAGCTGTCG
          CGACCCATCAACGTGACCTTTTCGTTCCCGCAGAACGAGGAGGATGCGGAGAACGATGAGTGCGAAGGTGATGTTGAAAT
          GGGCGCCTTTGCGGGCGTCGGCGAGAATCCGGAAGAGAGTGAGAATGCATTATTACTTGGGCAAACACAGCATCATCGAA
          CTCACATTGGTGCTACTTATGGTCATGAGGGTGCCAACCATGGAACAGCTTCCCAGCGATCTACTTCCACTTCGCCAAAT
          ATACATCATCCTCGGCGCGGCTTAAATAAAGTCCACAGCAAAGCCTCGAACTATTCACATGGCAATTCGTCTCGTTCCAG
          CATTCAGATGCTGCCCATTATCTCGGGGCAGGTTCCGGAATTCGAATACGGTGCATTGCAAGAGGGTTCATTGAGCTCTA
          CAAACTCGGTAAACAAGTCCTGGCTGGGAACCGAGAACCACAAGGAGGATTTGTACTTCTGGATGGCTAAACAGCAGGAC
          AACAAAAAGAAGCACTTCACTGAAAAGGAACACGCACGCCCAGCTCCTCCGAAAATGACTGAACATGCAGGACAAACACG
          CAGTGGCATAATGCAGGATTCCATTAAGCTGCTCGATGCCCATCTGATCTTTGAACCACTTCTCACCTGCTTGGGAGTGA
          TGCCACAACAAATGATCAACAAGTTCTCCAACGCAGACATTTCTTCGCTGGAAAACTTTGGCACAAATCTCTCTTTGATC
          GGCACTTTTGATTCTATTCGGGTGGACATTGTGGTCAGCGAGGCGGGTGACAAAAAGAACTCTGCCCAAAAGCCAGCCAA
          ACTGAACAAGAAATCAAACGGCGGCAGGGCCTCCATAATGATGGACACCCCCTTGTTCTTATGCGAGCGAGTGGGCGTGG
          AGTTGGAAGTCTTAAAAATGTCCGATGGGATGGTGGATCAGGCGCGACAGAATGTTATCTATATGTCGCGTCGCCAGCTA
          AAGAAGCACACCAGTACTGTGATCAATTTCAGTCTAAATGTGAGATTCATCTCGCAGCAGGTAAATATGCCGCTGCTGAG
          GCTGCTACATCAGATCTGCAATATGTATCAAAACGTAAAGGATGCCCAGAACGAGTTTCACGATCAGCCTGAGCTAAGCA
          AAAAGAGCCAAACCAAAGACGAGTGCAGCTTGGCTTCTGAGCCCACAGACATCGTGCCATTTAATTCGATGTCCGAGCGC
          TATAACCATGCTGAAAACTATTCAGATGAACGCTATGACAAATTCAACGAAACGATGCCCACAATGTTGGCAAGACCGCG
          TCCCGGAGGCTTGGCTCCAATTATTCAACTGACACCTTCTCCAAATGCCAAGAACAGACCCCAGAGCTTCGCCCAAAAAC
          TTAGATCCACTGGGAAATCCGTGAAGGGCAAGTTGGGCTACACGAATTTGAATGAGTCCAGTTCATCGCCACTAAGGGAT
          AGTCCAACAATGTCGCTCCACGAACATAATATCCTCAAAATGTCCACGGAGTCGAAAGCTTCGTTGAATGGTGCTTGTGC
          CACCAGTGTCAGTGGGGATTACCAGAACACGCTGACCAAAGCTGGAATGCCAACGATGGCGCCGATGTTAGAGACACCCA
          ACTGCTGGAAGACCATCTACCACCTGTTAGAGTTGTATGGTACAATGCCGGAGACCAAGACTGTGGTCCAAAGGAGCTCG
          TTGAACGAACACAAAAGCAAGTCTGCGGGCTTTGCGCACGACGATGATGACTTGGCCAGTGCACCAACACCTCTGCCCCA
          ACATAGGGAGATGTTGCTGGTAGATGCTTCATCTCAGGAACGAACCCGCCTGATAGTTTTCGGTGTGGCCAAGATTCACA
          AGACTCGCCTGCTGGCCACGCTTTCTGGCCTCAAGTTGGAATCGGAGATCACCACTCTTAATAGCACAGCCACTTGGAGG
          AAAAAGGCTCGTCCTGTCTCCTTGGAATGCTCCCTTACTGGTCAAGTGGGACGAGCCATGATTGTGCTGCTCGAAGGAGT
          GGCTCCCAGTCAACAAACCGTAGTAAAGGTAACCGTGGGTAAGAGCCAGACTCTCTATTCAAGCCTTTCCAAGCGTGGAA
          AGGATAAGAACAGTGGCCTGCTGTCGATTGGTGCTGTTAACATAGACATTCCGCAACATCCGGTGGCCCTACATGGAATG
          ATGACTCGAAGCTCTAAGCAGTTGTCGTCCACTCTACAGGAGCTGCGTGTAAAGCGTAACTCTGGTCGGTCCACGATGCG
          TTCGCATACCGCCGAGGAGCCTGAGTCTCCGTTCCATGCCCGCAACTCAGTTGGAGCCAGCAGTGGAACTGGAGTGGCCA
          GCGAAATGCGGGAGCGCACTGTTTCCGGCGGAGCTGGTGCCCAGCAGCAGCCGCAACAGGCGGCTCGCCGGGCAGCACAC
          ATGGCGCAATCCAAGACAGGCACAGCACAGCACCAGAATGGATTGCTTCAGCCCCTGGTCATGCAGTTCAATGTGCTCTT
          GCAGAGTCTGTCCATCAATGCTGCGCTACTTCCTTCGCTGCAGGCCCAGTATCGCATGAATCATGTTAGTTCCATGGGAG
          TAACTGGGCAGAGGGCAAAGTTTGTTATCGACCTACCCACGCACACGCTCAGCTTTAATACCAAAATTCAGAATGAGATG
          AACCTTCCATCGGAAGCTTGTATTGGCCTGCCACCTGTTCACGTTCTGGCGGAATACATTCCAGACCACCGCCAGGATCA
          CACGGAAAATGTCGAGGGCATTGTCCTGCGCCAAGGTGGCTACGTGAACGCCAGCGCCGAGATCGGCGAGTTCGAGCGCT
          GCCTGACCACAGATCTCCTAAACCATCTGGTCTTTGTGCAGAAGGTGTTTATGCGCGAAATCAACGAGGTTCTGCAGAAA
          GTTTACGGAGGAGAGAAACCTGTGCCCCTGTGGACGGAAGAGAGTGGCGATAGTTCCGGAGCAGTACAGGAGTCCTCGCT
          TAAGCGCATCCTCTTCTCAATCAACATTTCCATGAAACGCATCCAATTGACGGCTACTACACCCTGCTCCTCGGCTGTTC
          GATTCGAGACCGGAATCCTGGAGCTGCAGCTGTCTAACCGTGTGAAGAACCTAGGCGATATGAGCAATCGTAAGCTCTTC
          TTTAAGGCTCACATAGATTTCAACTTGTCCCTGGGTCAGATTATACGCAATGTGATTTTCGACGAGGCCGAGCCGGAGTT
          CCAGCAGTACGCCTTTTTCCACACTACCATTAACCTGAGGAATGCTTTCCAAGACGAACTGCTCAACGAAGACAAGGAGT
          TGATTCTGCTGACCCTGAAGAGACCACTGGTCTACGTTCAGCCAATTGCCGTGGACAAGGCGATCCTCGTGTGGCTTAAC
          TATAAGAATGCTTACGAGTACTGGGCGGAGAAGCGTGCGAATCTCTGCCACGAGCACGCTCAGCACAGTCTCCTTAGTCA
          GTATTCGGGACAGCATCAGAACCAAAATATGCAGAATCCACAAGTGTTCGATCGCGTGGCTTTTGGCCAGATTGCAGGCT
          CAAATTTGTCTACGCTCTTCCTGCAACTCACCGTGGAGGACATGGGCATTTGCTTGCCCCTGAAACAGGTCAACACTACG
          ACCTTTGGCTCCCGTTCATACCAAGACTTTGATGCCAAGGGCGCGGTTGTAATCACGCTGGAGAACACGATTATCTCAGC
          TTGCAACTCGGGAGCTTTAGTGTCTAAGGGAAAGTTCCAGGGTCTGTGCCTGCGATTTGCCGATGATTTTGAAACAAATC
          TAGATGACTGGAAGCCCAACAGCGCTGAGCCCATTATGAACGTTTGCGTTGTCTCCGAGGGAACCTTCGAGGTGTGTTCC
          CGCACTACAGCAGCTAAGAAGGGTGAGAACGCCAAGTGGCTGTTGAATGTCAAGTGGCAAATGGAGGGCGTGGATATTCA
          CCTGGATGTGAATATTGGCAAGCAGCTGAGTTCTCTTGGCCACACTCTTACCATGCTCACGGGATTCGAAGAGGATGAGA
          CCCAAATGGAATCACCGGACAGCGATGAAGGAGATCAGAGCTGCAGAGATACGTTTGTGCGGCGCAGAGGAGACTTCGAC
          AATTTGCCAGCTTTTGTATTTGATCCCACAATCGATTCCAAGAAGCGTTCCTTCATGATGGAGAAGGAGATGGCCGAACA
          GCTGAAGATTATCAATGATCTGCGTACTCTCGGAGCATCACATAATACCGTGGCCCACGAGGAAAGACGACTCCAAGAGC
          TACAAGCCATTTGCTACAAGTACTTCCGTAGAGATATGATTCAGAAGTGGAAAAGACCATCGCTGAGAAGGTCCCTGAAG
          ACCTACGGTCGCTCGCATTCTTACATTGGATCTGGATCTTCAGTGAGTGGAGTTGGCGTTCCGCAAACACTGGACAATGT
          TAGCTATACTGGCAGAAGACTGGACACAATTGCGTCCAATGATGAGATATCTAGCTTGCAAAGCACACCGGCCTCCTGTC
          ATTCCCGCAGTGCTTCCTTAAAACATACAACAGGAGGAGGAGTCATTGGAGGGGGAGTTAATGCTCTTGGACGAGTCACC
          TTCACAGAGGCTATGCGCCAGACTTCACTGCCCAATGCGGACACGGACACGGAGACAGCTGACAATGAGCTTGATTGGAG
          AGGGGATATCACGCCGAGTGAGATTGATGTTGATGGCACCTCCGTGGAAATGCGACGCAAGCATGGACATGGACAGAAAC
          AGCCGGAACCCAACATTGATTTTGAACTGGACATTAAGGTGCTTGTGAACTCTGGAAAATGCGTGCTCCATACGAAGGAT
          ACTGGTGAGGAGCGAGGCTACGCTGGTGGATCGGGAGCAGCTACAAGTGGTGTGCCAGCTTCAAGTGTAAAATCTCATAA
          GCGGGAAAAAAGCATAGGCAACGATTGGGGCAGTCCAACTCCCTCGAGAAGGCAGAGGGACAAGAGCAAGCTGCGCTACA
          ATGCAAATGCATTGCTGGCGGATCTCACCATCTTCCACATCCCAGGATTGGATGTAAAACTTCATTATCAGTCAAAAACA
          CTGGCCGAGCAACTAACCGGAGATCAGTTGCCAACTGGACGACGAATGGGCAGCAAACGAGCAACTTTGTGCGCTTGGAT
          GACTTTACAGAGTATACCAGAGGAAACAATCATATCACCCCATATTTTGGAATTCCTAGAGCAGACTCTAGAACCCATTC
          CGGCTCGGCAATCGAGTAGTGTTCCGCCAACTCCCTCCCACAACACAGGTGTTAATCTGGACATACTGCCTGCCAACTAT
          GTGACTTATGCTTCATTTCCGGTGGATGTAATAGTTTACTTTCATATGCAACCTTCTACCTTCAGATTTAGCTGTCTGCC
          AGTTTCTAGAGTAGAATGTATGCTTCAGCTGCCAAGTTTGGATATTGTTTTCAGTTCAAAGAGGAGCAGCGAGGAGGAGA
          ACTCAGCACAGCCAGGAGGTCATACCCAACCAGATCAGCAGCTACCCACTGGAGGACTTAGTGTTACAGGCTGCCTTGCC
          GACTTCAATGTGTTCATTTTCCATCCGTATGGTGGCAAAAAGACTTCTAAGGAGACACAGTTTTCACCTCTCAGCGACAG
          TGAAAGGAAGGATTCGTTGAGTATCAACGTGGAGTTCGTCAAGTTCCACATTACGCGTTGCAGAAAGGTGTACATTGAGC
          CTCTGCCCAGTTCTAAGAGATCTCTTGATCAATCGCGAGCCGTAATACGGTTCTCTACCATTGTGGATATTGGTAGTGCC
          AGTTTTAAGTACGACATGAGGAGATTGACTGAGATCCTAGCGTTCCCCAAAGCTTGGTATCGCAGGAGGATTGTGAGAAG
          GCTCTTCCTGGGTGACCTTAGTGTGCAGCAACAGCAGCAGCAGCAACAGGGAAATGGAGCAGAGACACCAACTGGCTGCC
          CACCTGCCACGCCAACGCCCAATGAAGATGCCTCTAGGGCAAAGGATAACATGCGCCTCGACTTTGATGGACAACCGTCG
          CAGCAGCAGCAGCAGCTGGGACACTTTGGCGCTGTAAGACACTTGAAAAATCTGGGCAAATCCTCTAGCGCCGAATCGTC
          GGGAACGCCTCCCTCTGAAAAGAACCAAATCACTGCCTGGGAGACTCTGGTCATCTTTGCAGTTAATTTTACCAAACTAA
          ATGTGCAAATGAACATTGGCAATGTGTGTGGCAATGTTGTCTGGCTCACAAAAGACTTTCAATCGGATGGACGCCTTTCG
          ATCGGAAGCACAGGCTACAAGAACATGTATGCTGGGATCTATCTGGGTGGATCAGCCCTAGATGCAAAGGGTGGTATTGT
          GGGTGGTAGTTTCGAGGTGAACAAGATCAACAAACGTTTTCATATCAAGGAGGAGGCGGGCATGGAGCCTTACCACACTA
          TGGGCCTGAGCTTTATGGCCCTGGAACTCCGACTAGATTATATGGGAACTTCAGTGTTGATGACCCGAATTAGTAGCTTC
          TCGGCTGCCATGAAAGATGAATGGCGCACTGCTTCCCAAGCGGCAGCAACTCCAGCACATGGCAAAGACCAACCCAGAGC
          TCTGATCTTTATTCACGGCGATCTTACCTGGGACCAACTGCAGATCATGATCAGCAAGTCAACAACGGCGGATCTATTGA
          AGATGTACTTCAAATTGGAGGAGTTCTTCACACAGCAATTCAAATCCTCCAAGAGGGTGTTCTCCAATCTGGAACCTCGC
          CTCCAGGATCGGACTGCCAGCATCAAGAGACGGCAGCAGCACAAGAAGAAGCCGGCAAATGGAGAGCTTGTTGCTCCACC
          TCAGATTCATGGCATGATTGGCGAAAACACAGACGCACGCCATCACCGCCATTGGCAGAAGCCATTGGCACAAGCTGTAG
          GCCTGGTTGTGCCCTCACTAGTGACTCGTTTGCCACGTCATGGTAATGTGTTGGGTGGCACTGTCGAACTTCGGGGACAG
          AACATCTCCCTGGCCTGCTTCCACGGAATTAACTTCAAGTCTAAGTCCTGGGCCCTGTTCAGTTTGAGATCTCCATCCAT
          TAACTTTGCAACTGAGGCGCGTCAAAGCGAGGACGAAGTGCTGGTCACCCAGACACTCACCTCTTCGTTAGGACAGACAA
          CGGAGGTGCAGCAGCAACAGAACCATTCTATGGCCATCGTGAGTCGAATTACGAGAAACATCATTTTCCCGCCTCAGTTC
          AAGACGCTTAATGAGTGGTTCCATTACGCTTTTGCTAACAGTGAGATTGATGCTGTGGATCGATTCCCCATGCTGGAATG
          CGAGCGGGAGATCGCATCCAATTCTATAGAGCGAACACGGGCTTCTGGCAGCAGCAGCGCTGCCAAGGCCCAAGAACACA
          ATCACAACCGCGAGGTCATCTTCGCCCTGCCCAGCCTGCAGCTGCATTTCAAGACTGAGCACAAACAGGGACCAACCACA
          CCAGAGCCAAGTGTTCTATGTTCGATTGCAGAAAATAAGCCAGAAGTTTTGTGCAGCTTCATCACCGAATTCGATGACCA
          CATTTTTGTGACCGTCGATGCGGACGCCTTCTTCTTCCTCCACGATCTCATCACTTCCTATGTGACTGAAAAGGAGAAGG
          TGATCGGAGCTCAGTCGGCAAGGGCAGCGTCGCCCAATCTCTCGCAAAAGGCTAACCTGAAGCCATATCTGACCGACGAG
          ATACTCAAAGAGAAGAAGGGCGCCTCAAACACGAACCTGACTGCTCAGGGCAAGCAAACGAGCGGCAGCAAGAACAGTTT
          GGATCCGCTGCAAGGAAGCCACACAAGCCTTGCGAACGCTGCTGCCAACATGTCAGGAGCAGCGACAACGAACACGACGA
          CCACCACAACAGCCACAACCTTATCACCTGGAGCGGCAGCTGGTGGACCATCGACAAGCGCTACAAACGACTCCGTTGAT
          GGCAAGCAGCAGCAACAGGAGGGTTCCCCGCCCACCTTTGATCTCGAATCGTTTGTGCGTGACTGGCGGCACTTTGAGTG
          CCAGACCTGGCACTTGGAGCCGACAGTTCGCCTACTCTCCTGGGCGGGCAAGTCCATTGAGCCATATGGCGTTGATTACA
          TCCTAAACAAACTGGGCTTCAGCCATGCACGCACCACCATACCAAAGTGGCTGCAGCGTGGATTTATGGATCCGCTGGAC
          AAGGTGCAGGCCCTGATGATGCTGCAACTGCTGTTGATGGTGCGCGAGAACAAAGTGGAGCGTGATAGTGGGGCAAGTGG
          AAGTGGCAAGCAGCAACAGCAAAACCATCGACCCCCAACGAATTAGCCATGGCAGAGTAGCATCTATGACAGTTGACAAT
          TACCCAAAGTCCTTCGATTTAGTCTAAGTAGCGATGTATAGATTTTTCAAACGTGTAAAGTTTTTATTATTTATTACCCT
          GGTTGACCTAGCATGCTTTAAGATTGAAACTGGCGGTATTATGTGGCCAGTATGGCAGCTTCATATATAATGTAAATGGT
          TTGCTCTCGTTCCCCTTCTTTTTAAGCGTATCTGTATACTCTTTCTATAGGTGTAACGTCAAGTGCTTCGTGTAATTTGC
          TCAATTTTTGCGCTTTGTAATTATCATTACATCGTTTTGTTATTTTAGAAATTACTAGCAACAATGAGCAGAGCAATGTG
          TTTAAACTATAAGTAGCTCTAATTCAATATACACAAATACTTATATTATTATATAAAAAATGTGTAAGTGTATCCATAAG
          TAAATTGAATAAAATTTCGGAAATGCCTACCAAAAAATTTCAAAACTACAGTAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0304927
          16289
          FBtr0304928
          16292
          FBtr0304929
          16352
          FBtr0304930
          16229
          FBtr0340173
          16334
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0309157
          5150
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0293466
          5095
          FBpp0293467
          5096
          FBpp0293468
          5116
          FBpp0293469
          5075
          FBpp0309158
          5110
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          tweek-RJ
          Secondary FlyBase IDs
            References (0)