Open Close
General Information
Symbol
Dmel\dl-RF
Species
D. melanogaster
Annotation Symbol
CG6667-RF
FlyBase ID
FBtr0340250
Feature type
Associated gene
Evidence Rank
Length (nt)
4481
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 7 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTGTTCAGACATTTGGCGAGTACTCAAGACGTTTTCCGCGTGTGTTTGATCGGTTCTACAAGAACATTTCTCTCGGTAG
        CACCTATAGATACGAATATATACATAGGTGCTCAGTTTAAAAACCAAAGCTACCATCTACAATAAAAAACGGATCATATA
        GTTATAAACTATAAATTATAAACAACTCGTAAATTAATCAACTTGTGTTGTCAACATTAGAATTAATAAATAATAAAACT
        TAGTTAATATCCGAAAATTTGCGATCTTATCTGTGTGGTGAAGTTTTTACCATCAAAGTTTGGCCGTGATAACTGAAAGA
        TAATATTTTGGCCACGTAATGTTTCCGAACCAGAACAATGGAGCCGCTCCTGGGCAGGGTCCAGCAGTTGATGGCCAACA
        GAGCCTCAACTACAACGGCCTGCCCGCCCAGCAGCAGCAGCAATTGGCACAGTCCACGAAAAATGTGCGAAAGAAGCCCT
        ACGTAAAGATCACCGAACAACCGGCAGGAAAGGCGCTAAGGTTTCGCTACGAGTGCGAGGGACGCTCGGCGGGATCCATT
        CCGGGCGTGAACTCTACGCCGGAGAACAAGACCTATCCGACAATCGAAATTGTGGGCTACAAGGGACGCGCCGTAGTTGT
        TGTCTCCTGCGTCACAAAGGATACGCCATATCGTCCTCATCCCCACAATTTAGTTGGCAAGGAGGGCTGCAAGAAGGGCG
        TCTGTACACTGGAGATCAACAGTGAGACAATGCGAGCGGTGTTCAGTAACTTGGGTATCCAGTGTGTCAAAAAGAAGGAC
        ATTGAGGCGGCGCTCAAGGCGCGCGAGGAGATCCGTGTGGATCCGTTTAAGACTGGCTTTTCGCATCGTTTCCAGCCCTC
        GAGCATAGATCTGAATTCGGTGCGATTGTGCTTTCAAGTATTCATGGAGAGCGAGCAGAAGGGTCGATTCACCTCGCCAC
        TGCCGCCGGTAGTTTCGGAGCCCATCTTCGATAAGAAGGCCATGTCCGACCTGGTCATCTGCCGGCTGTGTAGCTGCTCG
        GCCACCGTTTTCGGCAACACCCAGATCATCCTGCTCTGCGAGAAGGTGGCCAAGGAGGACATCTCCGTGCGATTCTTTGA
        GGAGAAGAATGGCCAGAGTGTTTGGGAGGCCTTTGGTGACTTCCAGCACACGGATGTCCACAAGCAGACTGCCATTACCT
        TTAAGACGCCGCGCTATCATACCCTGGACATCACAGAGCCCGCCAAGGTTTTTATTCAACTGCGACGTCCCTCGGATGGA
        GTTACCAGCGAGGCCCTGCCCTTCGAGTACGTGCCAATGGACTCAGGTAAACATACATTCTGGAATCTTCATCGGCACCT
        CAAGCGGAAGCCGGACGAAGATCTCTTTCAGCAGATCCTCAGGTTGGACGCCAAACGGGAAGTGCAGCCGCCAACGATTG
        AGGTTATCGATTTGGATACACCGAAAATAGATGTGCAACGTGAGATACCTTCGGAAATGGAATTTAATCATGAGGAATCT
        CAGCAATCAGAGCCAGCTCTTGAGCAAGAGCAGTCAGTGCAACAGGAGCAATATACTCAAGAGCAATCATTGCAACAAGA
        GCAATATACACAAGAGCAATCATTACAGCAGGAACAATATTTACAACAACTAGAACAGCAGCAATCTTTTCAGCTCGAAG
        AACCGATGCAACAGGATCAGGAACTACCAGCGCAGCAATCGTTCGATCAGGCTATAGATCACTTGCCCGATCACACCTCA
        GATCATATTCCCGAGGACATGGAGGCGGCGGATGCCCATGCAGAAGCCGAGGCCCATCGCCTGCGATCCGAGCAGGAAAA
        AGAGATTGACACCATTATCGATGAAAAGGTACGAGAACTGGAGCAACTGGATTTGGGTCAGCAGTTGGAGCCACGTCCTT
        TGACGGCCAACGATAAGATCACCGAGTGGATGAAGTCCAGTGAGATTGAACAGCAAGTCCATGAGCCCAGTCCCACTGCT
        GAGGCAGATGTTTTGGACTCCGCCCTTGAGATATCCAAGGCAGATAAGACCCTTGACGAACTCCTTGAGACCGTGGCCGA
        ACTGGATGAGATATACACGGACTTCAAAGTTCAGAGGGATACGTACAAGAATACCATACAAAATGAGTTGGCGGGACTTC
        AGGGTCGTGCGCCGCTGCAGGTGGAGGATAGCTTCGATGACGCTGCCACCTACACAAGCTTACAGATTGCCTTCAAGAAT
        CCCGTCCTCATACCCATGGATGATATAATGCCTCCAACTCCGCCCATGTCGCAATGCGCTCCCGAAGATGCCCATCAGCA
        TTACGATCCCGTCGAGGTGAACTCTCAGGCCCGCAAGCCGGAGACTCCGATGCGACCAGTTCCTCCAGTCCCGCCGGCAA
        TTCTAACAATTCAATATCCACCAGAAGAGGATAAGTTGCCCCCATTGCCACCGAAAAGAATTCGAAAGCAGGACAGCAAT
        GCTGAGAATCGATCAATCGAGGCCAATACGGTTCAGACCAAGCCATCTACAGGCGAGTCTCCTCTAAACAAAAGACTCCC
        ACCTGCTCCAAAGAACCCGAACTTTAATACACTGCCCAGGCAGAAGAAGCCGGGATTCTTTTCGAAGCTTTTTTCGCGCC
        GCAAGAGCAAACCAGATTTGGCCCAGGGGCAGGAGAACAGCTCTATATTGGATTCCAAGGCAAATAGCAGGGAGCCAAGT
        ATAGGTCACTTTAACATGCAAGACCCGATGAGGGCATCGCTGCGCTCCTCCAAGTCAGCTGCCCCGTTCATCTCGAATCC
        AGCGCCTGCCAAATCCAGTCCTGTCAAGGCCAAGAAACCAGGATCAAAGCTGACCAAGCCCGTGGGCAGGAGTGTGAGCA
        GTGTTTCCGGAAAGAGACCCGCCTACCTGAATGCTGATGTGGTGCATATACCGCTGAAAGGTGACAGTGTCAATAGTTTG
        CCACAGCAACAGCGAACCGAGGGCTACTCCCAATCCAGTACGATTTCGGTGGGAGCTGGGTTGGATAGACGCACTGCATC
        TGCACTACAGCTGGCTGACATACCAATTAGTGAGGGCGGAATGGAACTGGTTGCCATTGCCGATCGACAAAGTCTACACA
        ATTTGGTCAGCTCCATAGAGGGTCACTTCAATGTCCAACTGGACCCCAATTTGGATCTGACCGAGGCCGAGCACTTTGCC
        CTGTACACGAGTATTCCGCCACTTGCGGCGGCCAGTGAATTTGACGAGACCTCCGCCTACTATGCTCCCGTGGATGCTGG
        CGAGATTTTAACGCCGGATGAGGTGGCCAAGCGATTGGCTGCGGCAAATGGCATCTAGATTTGTTGATTTGATTGTTTAT
        ATTCTTTATAGGCAAACGAACCGAGGAAAATCCTCGAACGAAACCCAATAACGAAGCAAGTTGGCTTCAAGCCAGTGGAA
        ATTGCATTGTATTTCTCGGAATCTGTTTCCATTAACTCTGGCGCCACAAATTGTCCACTTGTTGTAAGGCCGGCTGGAGC
        GCAATGTCTTCAGTACCTTAATGAATTTGTATTTGTTTTATAATTAATAATTGTGCTAAAAGTATCCCCAAAATAATTTG
        TAAGTGATACCAGGCAAAAGACCCCAAAGAAATGGGTCAAACCCAATGATTTGTTTGTTGTCCAGGTGGCCCATTTGAAG
        GGGCCAACCTAACTATTGTATTTAAGCGAAATCACTCAATTTTCAGAGTAGCGTAAGATTTCCCAATGGAATCGAATATA
        TTGTTTAAATTGAAACCGAAAACCCGATCATATGTACCTACAACACGGTGTGTATATTTTGTCTTATAGATCCAGCGCAC
        TTGAGGCGGAAACGTCAGAAGACTGGCGGTGATCCCATGCACCTGCTGCTCCAGCAGCAGCAGAAACAGCAATTGCAGAA
        TGACCACCAGGATGGCAGTAAGTTGACTGTTGAGATTTTTCCCAAACTGGTGTCGGTCTTCTCTATCCTCTATTGTGTCT
        GTCGCGACTTTGAGTCGATTTTTTCCCATGTGTTTGAATCCACTTGGGTACACATACTTTGTTTTGAGATGGATGCTAGA
        CATCTAACTGAATCCTACCTAGTCAAATAGCATCATATATATTTGATGTTTTCTTCGGTATACCAAAGACTACTTAACAA
        ATCATCGCCCCCGATGACGTATTACTCGAATAGACTCTTTTAGAAACTATTAGAAAGCACTCAATCAATGCACAAATCCA
        CTCACCCAGAACACCATGAAATCTACGTAAAGGGGGGTAATGTCCCCACTATATTTATATATTGATTTACATGATTAGTC
        GAAATTATAGTCAAGAAAATGAGAGATTGATTCGAAATCAATATGAAATTTTTGTCGCTTTTCTACTCGTTTACATGCGA
        AGAATATTTGATATTTTTATATACGAAAAATTAAGAGTTTGGTAAAAATATTTTGTATAAAATATTGTAGCTTAATAAAA
        C
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0081005
        2489
        FBtr0081006
        2833
        FBtr0081007
        4724
        FBtr0301383
        2590
        FBtr0301384
        2504
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0309222
        999
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0080558
        677
        FBpp0080559
        677
        FBpp0080560
        999
        FBpp0290597
        677
        FBpp0290598
        677
        Comments

        Transcript terminates at site supported by isolated cDNA; supported by RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        dl-RF
        Secondary FlyBase IDs
          References (0)