Open Close
General Information
Symbol
Dmel\hep-RF
Species
D. melanogaster
Annotation Symbol
CG4353-RF
FlyBase ID
FBtr0340303
Feature type
Associated gene
Evidence Rank
Length (nt)
5344
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 127 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GGCTGATGCATCGATGTTTTTTTACATCACTATTGTACACGCGATTTAGGCAGCAAAAACGTACAAAAGCGAGTGATCAA
          ATTGTGCCAGTGATACCGCCGCCCGCGGTCGCGAAACGAATCGATTGCAGAAGTGCGACAAACAGCGCCGCGAAAGGAAA
          ACAACCGATGAAATATTCTCCCAAAAAAGGAGGAAAAAATCGCAAGTTGTTGTTGCCGTTGCTGCTGAAAAAGAAAGAGA
          GAGAGGGCGCTGCGTGTATGCCTGTGTGTGTGCGTGTGTGGGGGTGAGGATGTCTCTCTCTAATGCACAGTGACTGTGTT
          TTCCTTTTTTCGATTTTGTTTTTGTGCCCCCCCTTGGCAAACAACAAAAGTCCAAGCAATCCTTTATTTTTGCAAGTGTA
          AAGTTTACAGTGTATGTGTGCCGCCGAACAACAACAACATCAGCGACAAAACAAACAGGGCGCACAGCAAAACAATTCAC
          ACACACACGCACCCTCCCCCGCCTGCGCGCGCTTGTGTGTGTGTGAGAGAGAGGGAGTGAGTGAGAGGAAAATCGAAGAA
          GTGCTGGCCAAAAAACGGCGAAAAAAATTTAATAAATACCAAAATCCAACGATACTAGCAACTAACTATAAAAAATCGAA
          CCAAATCGACTCGATATAATGTCCACCATTGAGTTCGAAACGATCGGCAGTCGGCTGCAATCCTTGGAGGCAAAGCTCCA
          GGCGCAGAATGAGTCCCACGACCAGATCGTCCTCTCCGGTGCGCGCGGCCCTGTCGTTTCCGGTTCCGTTCCATCTGCCC
          GCGTCCCGCCCCTGGCGACATCCGCATCCGCAGCCACATCCGCCACCCACGCACCTTCCTTGGGCGCAGGTTCCGTTTCC
          GGATCGGGTATCAGCATAGCCCAGCGTCCAGCACCTCCAGTTCCTCATGCGACGCCCTTCGGCAGCGCCAGCGCCTCGTC
          ATCATCCTCATCCGCATCCGCATTTGCATCCGCAGCACCGGCGACGGGCACCTTCGGTGGAACATACACCCCGCCGACAA
          CTAGAGTGTCGCGAGCCACGCCCACACTGCCCATGCTTTCTAGTGGTCCCGGTGGTGGACTGAATCGTACGCGGCCGGTG
          ATACTTCCGCTGCCCACGCCGCCACATCCTCCAGTTTCGGAAACGGACATGAAGCTGAAGATCATCATGGAGCAGACCGG
          CAAGCTGAACATCAACGGGCGGCAGTATCCGACGGACATCAATGACCTCAAGCACCTGGGCGACCTGGGCAATGGGACTA
          GCGGCAATGTGGTGAAGATGATGCACCTGTCCAGCAACACGATCATCGCCGTGAAGCAGATGCGACGCACTGGCAACGCG
          GAGGAGAACAAACGCATCCTGATGGATCTGGATGTTGTGCTCAAATCGCACGACTGCAAGTACATTGTCAAGTGCCTTGG
          CTGCTTCGTTCGCGATCCGGATGTGTGGATCTGCATGGAGCTGATGTCCATGTGCTTTGACAAGCTGCTCAAGCTGTCCA
          AGAAGCCGGTGCCGGAACAGATCCTGGGCAAGGTCACAGTGGCGACGGTCAACGCATTGTCCTACTTGAAGGACAAGCAC
          GGAGTCATCCATCGAGATGTGAAGCCCTCGAACATTCTGATCGATGAGCGCGGGAACATCAAGCTCTGTGATTTCGGGAT
          CAGCGGACGCCTGGTGGACTCCAAGGCCAACACTCGATCCGCCGGCTGTGCAGCTTATATGGCGCCGGAGCGCATCGACC
          CCAAGAAACCAAAGTACGACATTCGCGCAGATGTGTGGTCACTGGGCATAACGCTGGTGGAGCTGGCCACAGCGCGATCC
          CCGTACGAGGGATGCAACACGGACTTCGAGGTGCTCACCAAGGTGCTTGACTCGGAGCCGCCGTGTTTGCCATACGGCGA
          GGGTTACAACTTTAGTCAGCAGTTCCGCGATTTCGTCATCAAGTGCCTCACAAAGAACCATCAGGATCGACCCAAGTATC
          CGGAGCTTTTGGCCCAGCCCTTCATCCGGATTTATGAATCAGCCAAAGTAGATGTGCCCAATTGGTTTCAGAGCATCAAG
          GATAACCGACTGCGCGCCAATGGCGATCCAACGCTCCAGAGGGCAACGGCGACTGGAAGTGCGATCGGTTCTGGGGCCGG
          ATCTCTCGCAGGATCAGGATCAGGATCCGCAGGTGGAGCTGTAAAATATGGTAGGGCGACAACGTATGCGGGGCAGAGTC
          CCACAAATCCGCAGAAGACAATAAAACCCACTCAGATACCGAGTTACCAGCAGCAACAGTCGCAGTTTTTCATGCAATCA
          GCCACACAACTACCTCAAACAACAACCACAACACCGACGGCAACGACAAACTGTTTCGGCGGCAGCGGAAACGGAAATGG
          AAGAGGAAACGGCAGCGGCGGAAGCGGAAATGGTAGCGGAAGCAGCAGCAGTGCCAGTCCTCTATCGCCACCAAGCGCCG
          GTATCGGCGATCTTAACCGGCTTTATCGCAAATCGCCGTTCATGCAGCGAAAACTGAGCAACGGATCCCATCATCCGCAC
          TACAAATATAACGACGAGAGCCCCAAGAAGGAGTCCATGTTTAGTAGCATCGGTCAATCGATTCTACGCAATCTGACAAC
          ATCGCCCTTCAGCCAAAAGAAACACAATTCAACTGCAACAACAATACCACTGCCGCACAACAACCAAACATTGATCACGG
          ATGCAGCAACAGCAGCAGCAGCGGCGGCAACAGCAACAACACCGCCAAATATTGCAGCTACAGTGCTCACGACAACGCCA
          ACGACCACGCCCACTTGGCGCCTGCCAACGGAAAATTCCCAAGCCTACGACAGCTGTGATAGTAGTAGTAATGCGACCAC
          GACGACCTTGAATTTGGGCCTCTCCTCACCCTCCCCCTCGTTGCCGCGCAAGCAATTCCCCACAGAATCGCCGACCCTGC
          AACTCACGAGTCAGCAGCAGCAGCAGCCACAGCGATTGCAGCCGGGCAATCAGAGCCCCATAGTGCTGCAGCGCTTCTAC
          CACCAGCAGAATCAGCTGCGCGAGAAGGAGGCGGCTGAGCGGTATCAGCAGCAGCGCCAGCAGCCGCCCGTTGGAGTGAC
          CAGCACGAATCCGTTTCACAGCAACTATGTGCCGCCGCCGCCATCAACGCACTCCACCTCTAGTCAGTCCTCCACGCAGT
          CGACGTGTTCGCAAATCGCCATCAATCCCGCCAGCATATCCCCATCGTCTGGTTCCGGAACGGGAAACATGGCGGGATTG
          GGAATCGGTTCGGCTCCGGCATCGGGATTGGGGGCAGCTGGTCACTTTGGAGCGGGCGGCACTGGCGAGCAGCTGCAGTA
          TCAGCCGCTGCCCATCGCCGCCGAGGCAACGGGAACGAGTCCCACGCTCCAGTCTAGATCACCGGAACAGCAGTCGGATT
          ATGGAGGAAACGGCAACATGGTGGCCAGTAAGCTGAGCAAGCTGTACGCACGCCGACAACTTTTGGGCCAGAGCTCCAGC
          AGCGGAGCGAGCAATAGCAGCCTGGACGGTTGCAGTCGGGAGCAACACGATGCAGCCACGTCGCCGGTGGCGTCCAGCAT
          GGATCGAGACCAGGAGCCAGTGCATCCGCAGCCGCCGGCGTACAGGAGCGTTGTGAATAACGGCAGCGGTGGCAAGTCTT
          ACTACTATCGCACCTTGTCGGCGGCCAGCAGCAGTAGCAATACCAGCCAGAGCACCTCGCCCACGACGGAACCGCTGCCC
          GGCGGTGGCACCAGTAGCTTTCTGCGTCGCTATGCAAGCAGTGGACCGGGAGGTAGCATCAGCACGCCGCCCAGTCCGCA
          TATCTTGGCGGGATTGGATCGCAGGCATCGAAGTCCAGATCCGCCGCCACGCTACAATCGCGGACAGTCACCGCTATTGC
          TGCGCAAGAATCTGCTGGAGCTGAGTGGCCAGCCGCCCGGCTCTCCGCTGCTGCACCGAAGATACGTTTCGGCTTCGCCG
          CCGCTGCCGCCACCGCGTCGAGGCTCTGAAAGCGTGCCGGGATCACCGCAGCATTTCCGCACTCGCATCCACTATACACC
          CGAGCCCCAGAGACGCATCTACCGTACGATAGATCAATGAGTAGCGCTGCAAATCATGGTCATGTGATGCTGGTATGGCT
          TCGACGACGATGCCGCCGACGCTGCTGTTCACGACGACAATCAGGACGAGGAGGTGGGACTATTGGAGCCCATTTCCCTG
          CCCGTCTCGTCAGCAGTCGGCGACTCGCTGTCGATGCCGGCGTATGCAGGTGGCCTGGGCACCAGGTTGTCCGGAGCCGA
          ACGGCGAATCGGCGATCGTCGGACGTGTTCGGCCAGCGGATCGTATTCCAGCTTGTATACGGATAAGGACGAATGGCCAG
          GTGGATCGTCCGGTGGGGCATCGGGTACATCGACGACCAGAGCTGGATATCCGTGGACATGTGATTGATGACAAACGAAA
          GTGTTCAAAAGTCTTATACGTTTAAGTGCTTGAGCCTCAGCGATTCATCTGTATCCGCATCTGCTAGACACTTCGTTTCG
          TTGCGCAGCTCCAATTGTACATAGACATATATCTTAAGGGACCTATATAGACACATCCGATAATAGTGCAATAGTTGAAA
          GCAATTCTGTTCGCCCAACAACCGCGCCCCCCCCTGTAACCAAGTCTATACTGTTCTATATATCTCTGTATCTGTATCTC
          CTTCAATGGTAACTCTGTAATCAAAAGTTTACACTTTACACAACGTAACTTATTTAATCGTAGCTCTAAAAAGAAAATGA
          AACAAAATAGCTAAATCGAAAAAAAAGGGGAAAATCCAAGAGAAAGAATGAGAAATTTAAATGATTTGTAGCTTTGTATA
          TAGAGAGGAAGCGAAGTGCAAAATGTCGTTGCATTTGCTGTTTGCAATTTGTTTTAGTTTATATGTTTCATTAAACATCA
          ACTTGTATGCTGAGTGGAAGGGAAACCGACAAGAAACAACCACATTAACAATGGAATTATTGTACTGATTATTATAATTG
          TTTAATTTATTATGTAAGCGGCAACAAGCGACAATTCAAATTCAAGTCTCGTTTTGTTTTTTTATTTCAAATGGGTGGAA
          CGGATTCCTTTTTTTCAGAACTTTTATATGGCGAAAGGGAAGTATGGAAGTAAATGGAGATATAAACAGTTCAGAAAGAC
          AACGTATTTGGAATTGATTTAATGATTAAATCAAAAGTATTTTGAATAGCTTCAGAAGTACAAGCCAAATAGCTTTCCAT
          ACACTTAGTTTCTAGTTTCCACCCTCCTATTAATATAAAGAAAATAAAAAAAAAAAGAAAAAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0073747
          4893
          FBtr0073748
          2738
          FBtr0330396
          5344
          FBtr0330397
          5689
          FBtr0479992
          4893
          FBtr0479993
          4893
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0309264
          1153
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0073578
          1178
          FBpp0073579
          492
          FBpp0303422
          1162
          FBpp0303423
          492
          FBpp0428279
          1187
          FBpp0428280
          1294
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          hep-RF
          Secondary FlyBase IDs
            References (0)