Open Close
General Information
Symbol
Dmel\CG14071-RC
Species
D. melanogaster
Annotation Symbol
CG14071-RC
FlyBase ID
FBtr0340560
Feature type
Associated gene
Evidence Rank
Length (nt)
585
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            GACGCCAGCAACACATATTTACCAATCATAAAAAACCACAAACTCCTTTCAACGGCGTAACTACACTGTGCAGCAATGTC
            CAGATCGGCAAAGGGCTTTGGTCGTTTAATCAATCCGGGCGTGGTACTCCATCCGGAACTGCATCAAAAGATGGCCGACT
            TTGAGGCCATGACCATCGAGCGATCTGATTTGGATCACGAATTGAGCCGATTGCGCAAGCAGCAGGACGATACCGAGGAT
            AATTTGGCAGAGGCGCTGGCCGAGGACGAGTTCCAGTGCAATTTGAGTGGCCAGCCATTCGTTGCTCCCAACGAGGACGA
            GCTGCAGGAAATTCTGAGGAATCACCTCGGTAGCATTATCAACAAGCTGGCTGCCACGTACGAGCGCCTTATTTACCTGG
            ATGCGGACATCAGGAAGCTGAAGGGAGTCATTGAAAAGGCCATCACAGTGGCTAATGAGGAATCGGCAGCAGCCGCCTCA
            ATGTGAAGATATGTATTTAACCATTACATACGTTGTACTTCTACATATGTGTATCTTGAAAATTTCAGTTCGATTTAATG
            TGCAAGTAAAGTTTGCAAGTATGTT
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0080178
            659
            FBtr0305259
            1225
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0309455
            136
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0079767
            136
            FBpp0293783
            136
            Comments

            Transcript terminates at site supported by polyadenylated cDNA.

            5' UTR based on RNA-Seq data.

            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (1)
            Reported As
            Symbol Synonym
            CG14071-RC
            Secondary FlyBase IDs
              References (0)