Open Close
General Information
Symbol
Dmel\Pvf3-RF
Species
D. melanogaster
Annotation Symbol
CG34378-RF
FlyBase ID
FBtr0342658
Feature type
Associated gene
Evidence Rank
Length (nt)
4852
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTCGTTATCTGAACGTCGGGAACTGTGGATTTGTCCGCCCCTACGTGGAGCCACGCGATCTGAACTTACCATTTACCGG
          AGCCAAACGGAAGTGCCATATCTCCATCTATTCCTATGGAACTCCGCCATCTGGCACTGGAAATCAAAACAAACAAATCA
          TTGCACAAACAAGCGCTAAAGCATCGCACATACAGATATATACTCCGGAGATATATACTCGGATGTGCGTGAGTGGATTG
          GTGGGTGTGTTTTTCTTGCCTCCTGGCATCGCGTCAAAAGTCGCGCGCGGATTCTGCGGCGGATTTATGGCCGCGGTAAT
          TGGTTAAAGCTAAGAATTTAATAACCATTAATCACTGAGTGTGTGAACAAATTGGCAAAAGATCAAAGGAAAAAGAATAA
          AGAATATTATAAAAAAAAATGAATGATTTGTGGTGATTAGTGTTGAAGTGCTAATATTTGGAAATACAATTGAAAACGAC
          AATAAAAAAGAGATAAATAAAAAATAAATTGACGTCGCGGTATATGGAATACCTATAAATTACAATAAAGAATAAACATA
          TTGAAATGAAAAAAAAATAAAATGTTATCTTAATACTTAAATGAAGTTTCTAGGAATCTCACACAACGCATAAATAAAGC
          TATAAATGCAATGGTATAATTAACAAAGACCCCGAGTAATATTTTAATGACATATAAAAATTAACATCCAGTAAAACATT
          TTTTACGAGAACAATTAAAATTCCATTTACGAAAAAATAAACGACTTAATTCCAACTCTGAACAATTAATATTCCATTTT
          AAGCCGGTAATAACGAATTATTTTAACTTTCAACAAGTGTCAAAACAAAAAGTGACAATATTAATTGCGGATTGTGGGAC
          AAAGGGAAATGTTTTAAACAAAACAAACGACAAAGGCAAGTGCCAACAAACGCATGTGAAAAATATCGACACAAAGAGCA
          GAGTATTCCTAGAAAAAAAGGCCAATATAAAACAATAAAATCCCCGCGGTGAAACGCAACGATCTTCGAAATGCATTGGC
          TAGTTCTGATACTAGTGCCCCTCGTCTGGGCCAATAGCAGTGATCTAAAGGGAGCACCTGTGATGACCACAGTAGCCCCG
          ACTGGCGGTCATCGAAGTCCCCATCAGCAGCAGAGATTGCAGCAATTGCAGGAGGCGCAACAACTGGAGGCCCATCAGCA
          GCACCATCATCATTTGCGGCACGAACAGCATCTGCGGGCCGAACTGGAGGGCAACCATCAGCCGCCGATCGAGGATGTCG
          AGAAGAAGGCCTTCCTCGATCCCCAATTGCCCATGCAGCAGCATCACTTGCGTCATCACAATCGTCATCATGCGAGCTGG
          GAGCAGCGGGTATTTCCCTCGCTGCGTCATCAGCAGCACCGCTTGTCCATCGGACCGAGCACGGCCAAGAACCTAATGAC
          CACCGAGGCACCCACAACCAGGCACCATGGCCTGATCTCCAATCACAGTCGCTATTTTGACAGGGACGGCATCTTTCCAT
          CCTGGGCTGAGCCTCGAACCACCAGAGGTCCCAATTGGCGACAGGAGGTGGACTCGAGTGATTCCGACGAGGACAGCGAT
          GAGGATGACGAAGATGACTACGATGAGTATGATGAGGATGGCGATACCTCGAATGGCGTTGATGAGGAACTGGCCCGACA
          AATGCCCAGATATTCGCTGTTCACCCAGAAGTTGCCACACATCGATTTAAAGGATACCGATTACAATGCGTACGACCAGT
          CGGATGAACTGGACATAGTTTCGAGTAGCAATCGCAACAGCAACAAGTATCCCAGCGTGGCCAATCCGCACGACAAGTCT
          GCTGGCAAGCGGAATATATTCGATTGGCTGTTCAAACATGATAGGGAAAAAGAGGCTGTTAAAAAGCCACACATCACAAC
          TACTTCAACGACAACAACAACCTCAACAACCAGCACAGTAAAGCCCACAATAATGCGAACCGAAAGGCCAAAACTGCAAT
          TAATTGATGCGAATCTAAAGAATGGCGGTGGCGAAGAGGACGACTCCAATGAGGATTCAGACTCCGAGTCGGAGGAGGGC
          TTCTCCAATGAACAGTGGAACAAAATCGAGCACCAACACCATCTCAGGCAGCAGAAACACCAGAAAGAACTACTGGCGAT
          GCGAGAGAAGAGCCGGAATACCCCTCTCATAAGGAACATTGAGAATGAGGATGTGGAGAACATTTACGCACGCAATTATG
          TTGCGGCGAAAGTTGGCCAGAAGAAGGAGGACCAGTTGGGAACCCCCGAAGCGGTGATCAAAGCGAGACGCCTCCATGCT
          CAGAAGCAGAAGAGTGAACGAGCTCTTGCCCACGCCCATATGAACCAGGTGCTGAAGGAGGCCACCTGCCGCATTCCCCA
          GAAACGTTGTCAGCTGGTCCAGCAGGATCCTTCCAAGATCTATACGCCTCACTGCACCATCCTGCATCGCTGCAGCGAGG
          ACAGTGGTTGTTGCCCCAGCAGAAGCCAAATTTGTGCCGCCAAGAGCACCCACAACGTTGAGCTGCACTTCTTCGTGAAG
          AGCAGTAAGCATCGCAGTGTAATCGAGAAGCGAACCTTTGTGAACCACACGGAGTGCCACTGCATCGAACGATCGACCTA
          CAACGAGGAGACGGCCATGGCCCACTACGGCCAGTCGGTGGTGCGGGCCACCATACTGAGTTGCACCTGTCCGAAGAGCT
          TTGAGAAGATCCTGCAGGACGATGGGCAGTGCAGGTGCGACTGCAGCTCCGGCAACTACGACTGCGACTGGCTGAAGCGG
          GGCAACGAGCACTTTGCCATGAACGATCGCAAGTGCATACAGCAAGGTCGCTGCAAGCCGCCCACGTGTGAGTTTGGATT
          GTACATGGACAAACACGGTCGCTGTCCCAAGCAACACGAACAGCCATCCTACAATGCCATGTCATAAGCGGGAGGAATCC
          CAACGTGAAGCCAGGAAAAGTATTATTTGGTCTGAAGAAAACTCAAATCTCAAACAAAGAGGAAAATCCAGAGCGATTCT
          TCTCTTCTGACAAGAGTAAAGGCGAAATGAGAGACGTGAATTTAGTTGCATATCCTATACAAAACAATAAGAAAGTAAAA
          CGATGGGTCGATTAGCAAGAAGCACTTTAAAGCATTTCTAGGAGTTTTCCCTCCTTGAAATCTGTAATGTCTAGAACAGA
          ATAATTGGAACAAATAAATCTATACATGGGTTGGGTCGGAAAACAACCAAAATGAATATTCGACAACAAGCAGAAAAAAA
          ATAACATTTTCTACAGGTTTAAATCAAAATTAAAGTTGAGAAAACTTTTACTAAGAAAAGTATAAAACAGATTATGCATT
          TTCTACTTCAAAAATCGACCCAGCTGATTGTGTATTAGATTTATTAGGACTCCAATCCGAAGAGCCATTAAAGTTAGGTG
          CAAACAAAAATCTGTATCTTAGCAAATGGAAATAAGACTTTTTTGCGCATGTTTTACTAAGAGATAGAAAAACACATAAG
          CCAATATGAATTTGTAGCATTGTTCTTAAGTGTTTCAATATACAACATCCACAAATAAACCAGAATAAATTATGTGTGTG
          TTTTATGCGTATGCTAAATGAAATTCCAAATATATAAATTGACTGCGTTTTTAGTTTTAATTGACTAATGTTATGTTATT
          TAATTAGTTATTTAATTATAATAAAACGAACAAACGAAAACGAATCACTAATATTACAATTGAAATATATAAATTACCCA
          TATAGGAGCAAATATATTGTTCATGTTATTTAAGCTAAGTTTTAACACAATTCAAACAAAAACCATCCTGGATAAGTCGC
          AACAAAAACAAAATTAAATTTTCATATTTAATTTCTAGTCAAATTTTCATTTTGTTTTTCCACGGCCACGAATGTTTAAT
          CGAATGGAAATTCCGCCATTGAACTCAGCAAATCAAACGGCATTTAAAGCGGAAAACAAAAAACAGTAAACTAACCATAA
          ATATAGCAGAATAAATGTATAAACCATATTGAACGTAAACTAGCCCACAACTTTCCTGCTTTTTTCTGCATTTGATAGTG
          ACAACTAAACTAAACATAGGATATTTTCAAATATCGCATAAGTACATTCTGGGAAAAGCCCGATTTTAGACACAATTTCA
          TTTTCATTCGACCCGTGCACATGCCTTAGTTTAAGTTACTTAAATAGTTCCGACACCGTATCGAGCACTGTACATATATT
          TTAGAAACCTACATTTAAGCGGCACACAAAAGTGAATCCGTTTGGCACGAATTATGACGCAAATTGTTTCAGAGGCAGAG
          AAATTATTCCCGCATTGCATAACGCATTTGCATATTAATGACATTTGCTTTATGGTTTAGTTATTAATATCAAACGGAAT
          TTGGGGCTTTAATTATTGTGAATTCATTTACCATTTAGCCAGATACCAAATGCCGTTTAATGACCTGTGCCTCATTTCTA
          TTTATCCTGCGTAATTACACGTTCGCCATAATTATGGAGCAATCTATTTGCTCAAGTTTAAATATTTATTGAAATTCGCA
          GCCCACTTTGAATAAGCAAGCATACGCATATAGGAAACGCAATCTCAATGCGACGTTGAATGTGTCATGAATATTTCAAT
          AAATCTGTGTAATTGTTAATAGAAGCTACCACAAGATACCAAGCAGAATATACGAAACATTACATTTCAAAATGATTTTA
          TTTACAACTCTTAGCATAAAATTTAATGTATAAAAATGAATGTAAGCGATAAGCTGAAAAACAAAACCAATACTAATAAA
          ACAAAACATATTATTACTATGCGAAAATCCAAATAAATATGAAAGTGAACAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0112612
          3486
          FBtr0112611
          3387
          FBtr0301525
          2485
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0309572
          638
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0111524
          482
          FBpp0111523
          651
          FBpp0290740
          469
          Comments
          Extended 3' UTR based on RNA-Seq and/or EST data.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Pvf3-RF
          Secondary FlyBase IDs
            References (0)