Open Close
General Information
Symbol
Dmel\CG9313-RB
Species
D. melanogaster
Annotation Symbol
CG9313-RB
FlyBase ID
FBtr0342788
Feature type
Associated gene
Evidence Rank
Length (nt)
2652
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTTGGCTCTGATTATGTGAAATACGCACGCATCAAAACATCTTTGAGGTCACTGTCAGGAAATCAAACAGAAATCACAA
          ACACAATTTCGGTTGTTGAAACGATTTTTTTAAATTTCAGGCATAAAGTTCTTTCTAAAACTTGAAGATTATCTGTGAAA
          AAAAACCGAAGAAACCGCCAGTAAAATGGCCACAAAACCGGGAAAAGGTGACGGCAAGCAGGTGAAGGGAAAACTGAGGA
          CCTCCAAGAACAAGACAGATGGCCCCGGCGGTGGTGGCGGCGATGCCGATGACTTCGATGCCTGGATGAAGTCGCGCCAG
          CTGCTCAAGCCCGATGACCAGCTCGATCTCACCGAGGCGGAACTGGGCGAGGAGATCACCAAGGTGCTGACTCCCACCAA
          CACGAACATCGTTCGCAATCTCGTGGTCTATAGCTTCAAGGAAGGCGAGTTTGTTCCGGCTCCGTTGCCCGGCAATACGG
          TCACCCTAATCGCCTTTGCCGGCAACTCACTTCACGTGGACTCCGATGAGGGTCGCCGTCAGATCGAGGAGTCCGACGAG
          ATTGGCTACCCACTGCCCATGCCCAACTACACTGTGGTGGAGCAGCGCGAGACGGATAACGTCGACGGTGAGGAGGGAGA
          GGGCGAGGAGGATGATGATGGGGCCACCGCAAAGGACGCCGCCGTAGAAGACGAGGATGTCGAGGAGGAGGACGACGAGG
          AGGCCAAGGGCACCGAAGGCGATGAGGGCGAGGGCGAAGGCGAGGGAGAGGGTGCTGCTGCCCGCCAGGAGGACGATGAG
          CCCGCCCACCAAGCGGCGGCCGTTTCATCCAAGAAACGCAAGCTAATCAACCAGTTCAACTACTGCGAACGTGGTGCCCT
          CACCTACACAAATCCCAAAAGGAATGTAGACACCCAGACCATACCCCCACCCCGTTCCCAGTTTGGAGCCAATGTGCTGC
          AGTGGGTCATCTATGATTCCTATATGGAGAACTTTGCGGAGTCCCAGAAGGACGGCACCAAGAAGGAGGAGCGCAAGCGC
          GGCAAGAGGGAGAAGAAGTTCCGGGATAAGTCGGCCATTGCCGAGCAGCTCAACAAGAAGTATCTCAAATGCTGGCAGAT
          ACTCGAGCGCATGATCAATCAGAATATCTACGATGACATCGCCCACGACTATCGCTACTGGGAGGATCCGGCTGATGAGT
          TTCGTGAGGGTGAGGGCAACCTGCTGCCACTCTGGAAGTTTCAGTACGACAAGACCAAGAAGATGAACGTCACCGACATC
          CTGTTCAATCCGAGCTACTATGATCTCTTCGCCGTCTGTTTCGGATCGCATGACTTCATGAAGCAGACCAATGAGGGTTA
          CTTGTGTCTGTTCACCGTTAAGAATCCCTCATTCCCGGACTATATAATTCAAACCGACTGTGGTGTCATGTGCTGTGACA
          TCCACCCAACGTATCCTTTCCTGGCCGTAATCGGTCTCTATGACGGCAATGTGGCGGTCTACAATCTGCGCGAGGACTGC
          AAGGAACCACTCTATGTGTCCAGAGGAGTCAACTGCAAGCACGGCGAGTGCGTGTGGCAGATCAAGTGGGGTTTGGACAT
          GGCCGATGGCGAGGTGAACTTCTTTTCGGTGTCCTCCGATGGGCGCGTCTTCAACTGGATTCTCATGCAGAACAAACTGT
          GGGTAACCACCATCATCACATTGTACCGCGAAAACGGACTGGTTGACGGACCAGATGGCACAAAGGTCACGCTGAAGAGC
          GGAGGATCCTGCATGGTGTTCCATCCAGTGGATAATAAGATATTTCTGGTGGGCACCGAGTGTGGTTACATCTACAAGTG
          CAGCACGGCGTTCAGCTCCAAATACCTGATGACCTACTATGCCCACAACATGTCCGTCTATCGCATTGACTTCAATCGCT
          TCAACAGCAACATCTTCGTGTCCTGTGGCGCCGACTGGATGGTCAAGGTGTGGGAGGATATGCGTCCAGATCCGCTGTTC
          ATATTCGATCTTGGTGCCGCCGTTGGCGATGTCAAGTGGGCACCTTACTCGAGCACCGTCTTCGCAGCGGTGACCACCGA
          GGGCAAGGTCCACGTTTTCGACCTAAATGTGAATAAGTACAAGGCCATCTGCATCCAGGCCGTGGTGCCCAAGCGAAAGA
          ACAAGCTCACCAGGTTATCCTTCAACGAGAAGCTCGCCTTCATTGTGGTGGGCGATGAGAAGGGCGTCACCACTTCGCTG
          AAGCTATCGCCCAATCTCCGGATGATGGTGAAGCCGCCGAAGAAGCAGCTGTATCTCGACCAGAACACCCTCCAGATTGG
          CAAGTTGGAGAAGCTGCTTTCCCTGGTGCGGGAACTTCCGGAAGGTTCAACTGCGGTGCCCGATGCAGCCACAACCGTGC
          GAAGTTAAATCCCAACTTTTAACCAATTCCAGAAACACACTGTTTTCAGAGTTGATGTATTATATTTTACACATATAGAT
          TATCTGCTGGTTCTGAAAGAATCCTGATTCATCCGTCTTGTGTTACGCTATGTTTCTATCCATCTAACAAAAATTTGCTA
          TCAACCAACAAAAGGAACTTAGAAGCAATGTATATATAGTCACAAAATTGTATATATGCTTAAAAACGAAATAAATTATA
          GAAACAACTACG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0071521
          2649
          FBtr0345666
          3069
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0309629
          740
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0071450
          739
          FBpp0311721
          739
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG9313-RB
          Secondary FlyBase IDs
            References (0)