Open Close
General Information
Symbol
Dmel\trol-RAH
Species
D. melanogaster
Annotation Symbol
CG33950-RAH
FlyBase ID
FBtr0342808
Feature type
Associated gene
Evidence Rank
Length (nt)
13564
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 74 )
Sequence
ACATTAGGTTGCGCGCCATCGTTCCAGGCGGTCGCACATTCCACGTGCCATAGCCGTAACCACAACCTGCCAGCCGTTTA
AAGCCAAACTAAACAAAACGAACCGAAACTGCCTTCACAAAGTACCTAAGCCAAACCTAAATAGCTGCCAAAAGAAACCA
AAACCGCCGTTACCCGGAAAAGAGATGATGGGATCGCCGGGATCCCAAGCGTCCGCGATCGCGACCTCGGTCGGAATCAG
AAGCGGGCGGAGAGGTCAAGCGGGAGGATCGTTGCTCCTGCGCCTCCTTGCCGTGACCTTCGTCCTCGCCGCCTGCCACG
CACCGCTGCTGACCAATGCCAAGCAAATCTCAAATCTTGGCGATGACCAAGATTTTATGCTGGCAGATGATGAGTCGCTG
CAGGGCATCAACGATTCCGAGTGGCAGCTCATGGGTGATGACATTGACGACGGCCTACTGGACGATGTCGATGAGACACT
GAAGCCCATGGAGACCAAGTCCGAGGAGGAAGACTTGCCCACTGGCAACTGGTTCAGCCAGAGTGTCCATCGCGTTCGCC
GTTCCATAAACCGTTTATTTGGTTCCGACGACAATCAGGAACGGGGACGACGACAACAGCGTGAGCGGTCGCAAAGGAAT
CGCGATGCGATTAATCGGCAAAAAGAACTGCGCCGCAGACAAAAGGAGGACCACAACCGCTGGAAGCAAATGCGAATGGA
GCGACAACTGGAGAAACAGCGCTTGGTCAAACGGACCAATCATGTTGTCTTCAACCGCGCCACCGATCCTCGCAAGCGGG
CATCGGACCTTTACGACGAGAACGAGGCATCCGGCTATCACGAGGAGGATACAACTCTCTATCGTACCTACTTCGTCGTT
AACGAACCTTATGACAACGAATACAGAGATCGAGAAAGCGTACAGTTCCAGAACCTGCAAAAACTTCTGGACGATGATCT
GCGCAACTTCTTCCACAGCAACTACGAAGGTAACGATGACGAGGAGCAGGAAATTCGCAGCACACTGGAGCGCGTTGAAC
CCACTAATGATAACTTCAAAATTCGCGTGCAACTCAGAATAGAGCTGCCCACTTCGGTCAACGACTTTGGAAGTAAGTTG
CAGCAGCAACTGAATGTCTATAATCGTATCGAAAACTTGAGCGCCGCTACCGATGGCGTATTTTCCTTCACTGAATCTAG
TGATATCGAGGAAGAGGCAATCGATGTTACATTGCCCCAGGAAGAGGTTGAGGGCTCTGGTAGCGATGACTCCAGCTGTC
GTGGAGACGCCACCTTCACCTGTCCCCGGAGCGGAAAAACCATTTGCGATGAAATGCGCTGCGATAGAGAGATCCAATGT
CCCGATGGCGAGGACGAAGAGTACTGCAACTATCCAAATGTTTGCACTGAAGATCAGTTCAAGTGCGACGATAAGTGTCT
GGAGCTCAAAAAACGCTGCGATGGAAGTATCGATTGTCTGGATCAGACCGACGAGGCTGGCTGCATTAATGCGCCAGAAC
CAGAACCAGAGCCTGAACCAGAGCCAGAGCCTGAACCGGAATCTGAACCAGAGGCCGAACCCGAACCCGAACCTGAGCCT
GAGCCTGAGTCTGAACCAGAACAAGAACCTGAACCCCAAGTCCCGGAAGCCAATGAGTGCCAGGCCAACGAGTTTAGATG
CAATAATGGCGATTGTATCGATGCCAGAAAGCGTTGCAACAACGTTTCGGATTGTAGCGAAGGCGAGGACGAGAACGAGG
AGTGCCCCGCCGCCTGCAGCGGAATGGAGTACCAATGTCGCGACGGCACGCGCTGTATCAGTGTGAGTCAGCAATGCGAC
GGTCACTCCGATTGCAGTGACGGCGACGACGAGGAGCATTGCGACGGAAGTGGCTATGATAGCGAGGAATGTCGGTTTGA
TGAGTTCCATTGCGGGACTGGTGAGTGCATACCAATGCGTCAGGTGTGCGATAATATCTACGATTGCAACGATTATTCCG
ATGAGGTTAACTGCGTCGAAGGAGAAGAGGAGGATAGGGTGGGCATACCCATTGGCCACCAGCCGTGGAGGCCAGCGTCC
AAGCACGACGACTGGCTGCACGAAATGGACACCAGCGAGTACCAGGTGTACCAGCCAAGTAATGTCTATGAGAAGGCCAA
TTCTCAAAATCCATGTGCAAGCAACCAATTCCGGTGCACCACGTCGAATGTTTGCATACCGCTGCATTTGCGCTGCGATG
GCTTCTATCACTGCAATGATATGAGCGACGAGAAGTCCTGCGAGCAGTATCAGCGTCACACCACTACACGACGCCCATTG
ACCTTGGCCACGCCCACCTCGAGAATCACCACCCAGGGCCCAGGTCTTCTGGAGCGTCGTAATACCACCACAGCCACCGA
AGCATCGCGATGGCCATGGGCAACGAAAACGACAACAATCGCGACCACGACTTCTAACCCAATAACAACAGTTGGCGTAG
CGAACAGCCCACCCCAGACATGCCTCGAAAACATCGAATTCGCGTGCCACAATCGCGATTGCATTTCGATTGAGAGCGTC
TGCGATGGCATCCCCGACTGCGGACGCAATGAAGACGAGGACGACGCTCTGTGCAAGTGCAGCGGCGACAAGTACAAATG
CCAGCGCGGCGGAGGCTGCATTCCGAAATCCCAGGTGTGCGATGGCAAACCTCAATGCCACGACCGCAGCGATGAGAGTG
CATGTCACCTCCATGGAAGGTTAAATAAAACTCGTTTGGGGGTCAAGTGCCTGGAGAGCCAGTATCAATGTGGCGATGGA
AGCTGCATCTCCGGCTACAAGCGCTGCAATGGCATCCACGATTGCGCCGATGCCTCCGACGAATACAACTGCATCTATGA
CTACGAAGACACCTACGACACCGACCCGAACAACAATCCATTGAATGAATGTGATATCCTTGAGTTTGAATGTGACTACA
GTCAGTGTTTGCCGCTAGAGAAGAAATGCGATGGCTATGCAGACTGCGAAGACATGAGCGACGAGCTCGAATGTCAGTCG
TACACAGACCATTGTCTAGAGTCTGAGTTCGAATGCGATAGCTACTGCCTGCCCCGCGATCAGTTGTGCAACGGAATACC
CAATTGCCAAGATGGCAGCGATGAGCGCAACTGCACCTTCTGCCGGGAAGACGCCTACCTTTGCAACACCGGCGAGTGCG
TGGCCGATAATCAGAGATGCAACGGCATCGCCGATTGCGCCGATGGCAGCGACGAGCGTCACTGCGCAAGGATATATTGT
CCACCTAACAAACTAGCCTGCAATGGCACTTGTGTCAGTCGGAGAATAAAGTGTGATGGCATCCGCGACTGCCTCGATGG
CTATGACGAGATGTACTGTCCGGAGACCAACAACCACTATCCCACACAAAATGTGAATGTTATACGACCAAAACTGGGCC
CCAATCCTATACCAAAATCGTGCCGCCCCCATGAATGGCAGTGTGCGAATCTCGAGTGCATCGATAGCAGTTTGCAGTGC
AATGAAATTAAGGATTGTTCCGATGGATCCGATGAGGAACTCAGCGTTTGCTTTGGCACTGCCACCACCCGACTCAAGCC
CAGCGACTGCAGTCCGGAACAGTTCTACTGCGATGAGTCGTGCTACAATCGATCCGTTCGATGCAATGGGCACGTGGATT
GCTCAGATGGTAGTGATGAGGTGGGCTGTTCACTGCCATGTCCGCAACACCAGTGTCCCAGTGGCCGGTGTTATACGGAA
AGTGAACGATGCGATCGGCACAGACACTGCGAGGACGGCTCCGATGAGGCCAACTGCTGTTACGCAAACCAATTCCGTTG
CAACAATGGTGACTGCGTTTCCGGATCGGCTCCCTGCAACGGATATTCCGAGTGCAGTGATCACTCCGATGAGCTCAACT
GTGGTGGAACCCAGGAGTGTCTGCCCAATCAATTCCGCTGCAATAGTGGCCAGTGTGTGAGCTCCTCAGTGCGATGCAAC
GGACGAACCGATTGCCAGGATAGCTCCGATGAGCAAAATTGCGCCGCCGATAGTAATGATCGCAGACCGAACCAACTGAA
TCTCAAGACCTATCCCGACAGCCAGATCATCAAGGAGAGTCGCGAGGTCATCTTCCGTTGCCGAGATGAAGGACCCGCAC
GCGCCAAGGTCAAGTGGTCCCGCCCAGGCGGACGACCACTGCCACCTGGTTTCACCGATCGGAACGGCCGCCTGGAGATT
CCCAACATTAGGGTCGAGGATGCCGGCACATATGTTTGCGAGGCTGTGGGCTATGCCAGCTATATTCCCGGCCAGCAGGT
CACCGTGAACCTCAACGTCGAGCGCTATAACGACGTTGGATCCCGTCCGGAATCAGCCTGCACGGAATATCAGGCCACCT
GCATGAACGGCGAATGTATTGACAAGTCGTCCATCTGTGACGGAAATCCGGACTGTTCGGACGCCTCCGATGAGCAAAGC
TGCAGTTTGGGTCTCAAGTGCCAGCCCAACCAGTTCATGTGCTCGAACTCGAAGTGCGTGGACCGCACCTGGCGATGCGA
TGGCGAGAATGACTGCGGAGATAATTCCGATGAGACCTCCTGCGATCCGGAGCCAAGTGGCGCTCCCTGCCGCTATAATG
AATTCCAGTGCCGCAGTGGTCATTGTATACCCAAGAGCTTCCAGTGCGACAATGTTCCTGATTGCACGGACGGTACCGAT
GAAGTTGGATGCATGGCACCCTTGCCAATCCGCCCTCCACCCCAATCTGTTTCCCTTTTGGAGTATGAGGTGCTCGAGCT
TACGTGCGTGGCCACCGGAACCCCAACTCCCACAATTGTATGGCGTCTGAACTGGGGTCATGTGCCCGATAAGTGCGAGT
CAAAGAGCTACGGTGGAACGGGAACACTTCGTTGTCCGGACATGAGGCCGCAGGACAGTGGAGCCTACTCGTGCGAAATT
ATTAACACACGCGGCACCCACTTTGTGAACCCGGACACCATTGTTACCGTTAGACCAGTGCGTACAGATGTGTGCGAGGC
CGGATTCTTCAATATGTTAGCCCGCAAAGCGGAGGAGTGCGTCCAGTGCTTCTGTTTCGGAGTAGCTAAAGCCTGCGACA
GTGCCAACTTATTTACATATGCCATCCACCCGCCGATCCTTTCACACCGCGTTGTCAGCGTTGAGCTGAGTCCACTTCGA
CAGATTGTGATCAATGAGGCAGCGCCAGGACAGGATCTGCTCACACTGCTACATGGCGTTCAGTTCAGGGCCACCAATGT
TCACTTCAGCGGCCGGGAGACGCCTTATTTGGCCTTGCCCGCGGATTACATGGGCAACCAGCTAAAGTCTTATGGCGGAA
ATCTACGATACGAGGTTAACTACCGCGGCAGCGGAAGACCCGTCAACGGTCCAGATGTAATAATCACTGGCAATCGTTTT
ACACTAACTTATCGAGTTCGCACTCAGCCGGGTCAAAACAACAGGGTGAGCATTCCATTCGTGCCAGGTGGATGGCAAAA
GCCCGATGGTCGCAAGGCGTCGCGTGAGGAGATCATGATGATTCTGGCCAATGTGGACAATATCCTGATCCGACTCGGAT
ATCTGGATAGCACCGCTCGCGAAGTGGATCTTATAAATATTGCCTTGGATTCGGCAGGCACTGCCGATAAGGGACTGGGT
AGTGCGTCTCTTGTGGAGAAGTGCCAGTGCCCACCTGGTTATGTTGGTGATTCGTGTGAGTCCTGTGCCTCCGGCTATGT
GCGACAGCCCGGTGGACCATGGTTGGGTCACTGTGTGCCGTTCATCCCTGATTCTTGTCCATCCGGAACTTATGGAGATC
CCCGTCGTGGTGTGCCCTGCAAGGAGTGCCCATGTCCACTAACCGGCAGCAATAACTTTGCCAGCGGCTGTCAACAAAGT
CCTGATGGCGACGTGGTTTGCCGATGTAATGAGGGCTACACAGGCAGGCGGTGCGAACAGTGCGCCGCCGGATACCAGGG
CAATCCTTTGGCTGCGGGAGGAATTTGCCGCAGAATACCCGATACTTCCTGCAACGTGGATGGCACCTACTCCGTTCATA
GCAATGGAACCTGCCAATGCAAGGATAGCGTAATTGGCGAACAGTGCGACACATGCAAATCAAAGAGTTTCCACCTCAAT
TCGTTTACATATACCGGTTGCATCGAGTGCTTCTGCAGCGGAGTGGGCTTGGACTGTGATAGTAGCACGTGGTATCGCGA
TCAAGTAACGAGCACGTTTGGAAGATCTCGTGTCGATCACGGATTTGTTTTGGTTACTAACTACATGCAACCCACGCCAG
ACACCGTACCTGTCTCAATGGCCGCAGAACCCAATGCGTTAAGCTTTATAGGATCGGCTGATCAATCTGGAAATACGCTC
TACTGGAGTCTGCCAGCCGCCTTTTTGGGAAACAAACTTTCTTCATATGGAGGCAAGCTGACTTACACCTTAAGCTACAG
TCCCCTGCCCAACGGCATTATGTCTCGGAACAGTGCCCCAGATGTGGTGATCAAGAGTGGCGAGGATCTAAGGCTCATCC
ATTATAGGAAATCCCAGGTTGTGCCCAGTGTGGCCAACACCTATTCCGTGGAAATCAAGGAAAGTGCTTGGCAGCGCGGC
GACGAAGTTGTGGCCAACCGTGAGCACGTTCTGATGGCACTTAGCGATATTACGGCCATCTACATAAAGGCCACATACAC
CACTAGCACCAAGGAGGCCTCGTTGCGACAGGTGACTTTGGACGTTGCCACTCCAACGAACCTTGGCACTCCACGTGCCG
TCGAAGTTGAACAGTGCCGCTGTCCCGAGGGCTATTTGGGTCTTTCTTGTGAGCAGTGCGCTCCTGGCTATGCCCGCGAT
CCGGAGGGCGGAATCTATCTGGGACTCTGCAGGCCTTGTGAGTGCAATGGACATTCCAAATATTGCAACAGCGATACCGG
TGACTGCGAAGAATGTTCTGACAATACCGAAGGTCCTAGCTGTGAACGATGCGCTGCTGGCTATGTGGGTGATGCCACCC
GTGGAACAATTTACGACTGCCAACCCGATGAAGGCTACCCGATCCCGAGTCCTCCGGCACCCGGCAACCAAACTTTGGAA
TGCACGGCCTATTGCCAAATAGAGGGCATCTATGATTGCCGCGGCAACGAATGCCTGTGCAAGAGAAACGTGATTGGTGA
TCAATGCGACCAATGCCGCCCTGGAACCTATGGACTGTCTGCTCAAAATCAGGATGGCTGCAAAGAGTGCTACTGCTCTG
GATTGGCCAGCCAGTGTCGTTCGGCAGCTCTGTACCGCCAGCTAATACCGGTGGACTTTATTCTTAACGCACCATTAATT
ACAGACGAAAGCGGAGCTGTCCAGGACACCGAGAACTTAATTCCCGACATATCTAGGAATATGTATACCTACACGCACAC
CTCCTATCTGCCCAAGTACTGGAGTCTTAGGGGAAGTGTGCTGGGCAACCAGCTATTCTCGTACGGTGGCCGCCTGTCGT
ACAGTCTAATAGTGGAGTCATATGGCAACTATGAGCGTGGCCACGATATTGTGCTTATTGGCAATGGATTGAAGCTCATC
TGGTCGCGACCCGATGGAAATGAGAATCAGGAGGAATACAATGTCCGATTGCACGAGGACGAGCAATGGACCCGCCAGGA
TCGCGAATCGGCACGACCGGCTTCTCGGTCTGATTTCATGACTGTGCTGTCGGATCTACAGCACATCCTAATCCGAGCCA
CACCCAGAGTGCCCACACAAAGCACTTCGATCGGCAATGTCATTCTGGAGAGTGCGGTGACCACAAGGACGCCAGGAGCT
ACGCATGCTTCCGACATCGAGTTGTGCCAGTGCCCATCCGGATACGTGGGCACCTCCTGTGAATCATGCGCACCTCTTCA
CTACCGCGATGCTAGCGGATCGTGCAGCCTGTGTCCTTGCGATGTTTCCAACACGGAGTCGTGTGACTTGGTCAGTGGCG
GATACGTTGAATGTCGTTGCAAGGCACGTTGGAAGGGCGATCGGTGTCGCGAGATCGACACCAACGATCCAACGGATATC
GGTACAGAAGATCCCGTGCTCACCCAGATTATCGTATCGATTCAAAAGCCTGAGATCACCATTGTGCCCGTAGGCGGTTC
CATGACCCTCAGCTGTAGCGGTCGAATGCGTTGGAGCAATAGTCCAGTCATTGTGAACTGGTACAAGGAGAACAGCCGCC
TGCCAGAGAATGTTGAAGTCCAAGGCGGAAATCTGTACCTGTACGATCTACAGGTCAGCGATTCTGGAGTCTACATCTGC
CAGGCCGTCAACAATGAAACCGCCAGCGTGTTTAAGGACACTGTATCCATTACCATAACCAAGAAAGACCAGCTCTCACC
GGCTGAGATTGTGAATTTGCCGAGCCACGTTACATTTGAGGAGTACGTGAACAATGAGATTATCTGCGAAGTACTTGGCA
ACCCAGCACCCAGAGTCACCTGGGCGCGAGTGGATGGCCATGCGGATGCCCAAAGTACCCGGACATACGACAACCGCTTG
ATCTTTGATTCGCCAAGGAAATCGGACGAAGGCCGCTATCGCTGCCAGGCGGAAAATGACCAGAACCGAGATGAGAAGTA
CGTGATCGTCTATGTTCAGAGCAATCCGCCCCAGCCGCCGCCGCAACAGGATCGATTGTACATCACACCGGAGGAGATTA
ATGGCCTGGCCGGCGAGTCCTTCCAGTTGAATTGCCAATTTACAAGTGTTGCCTCTCTGCGCTACGATTGGTCGCACAAT
GGTCGCTCCTTATCCTCTTCGCCCGCGCGAAATGTTGAGATCCGTGGCAACACCCTGGAAGTTCGCGATGCCAGCGAAAG
CGACTCCGGCGTCTACACCTGTGTGGCGTATGACGTACGCACCCGCCGCAACTTTACCGAGAGCGCCCGTGTTAACATCG
ACCGACGCGAAGAACAACCATTTGGCAACAAACCGATCATCGAGAGCTTGGAGCAGAATATCCTGATCATCCAGGGCGAG
GACTATAGCATCACCTGCGAGGCGAGTGGATCGCCATATCCATCGATCAAGTGGGCCAAGGTGCACGACTTCATGCCCGA
AAATGTGCACATTAGTGGCAACGTGCTGACCATCTATGGAGCACGATTCGAGAATCGCGGTGTCTACTCCTGCGTTGCCG
AAAATGACCACGGATCAGATTTGTCCAGCACAAGTATCGACATTGAACCCCGGGAGCGGCCGAGTGTAAAGATTGTATCG
GCGCCCCTGCAAACATTTTCGGTTGGCGCTCCGGCATCCCTCTACTGCACGGTAGAGGGAATTCCCGATCCGACCGTCGA
ATGGGTTCGTGTGGACGGCCAACCGTTGTCGCCGCGTCACAAGATCCAGTCACCCGGCTACATGGTAATCGACGATATTC
AGCTCGAGGATAGCGGAGACTATGAGTGTCGCGCAAAGAACATAGTCGGCGAGGCGACCGGCGTGGCCACCATTACCGTC
CAGGAGCCAACTCTCGTCCAGATAATTCCCGACAACAGGGATCTTAGGCTGACGGAGGGCGATGAACTCTCACTGACCTG
CGTTGGCAGCGGCGTCCCAAACCCGGAAGTCGAATGGGTTAATGAAATGGCCTTGAAACGGGATCTCTACAGCCCACCGA
GCAATACAGCGATCCTTAAGATCTACCGAGTGACCAAGGCGGATGCAGGCATATACACCTGCCATGGCAAAAATGAGGCG
GGTAGCGATGAAGCTCACGTTCGCGTTGAGGTCCAGGAACGGCGAGGAGATATCGGAGGAGTTGATGATGATTCCGACCG
GGATCCCATAAACTACAATCCGCCACAACAACAAAACCCTGGCATCCACCAGCCGGGCAGCAACCAACTCCTGGCCACCG
ACATTGGCGACAATGTGACCCTGACCTGCGACATGTTCCAACCCCTGAACACGCGCTGGGAACGCGTCGACGGGGCACCA
CTGCCCCGCAATGCCTACACGATTAAAAACAGGCTGGAGATTGTGCGCGTGGAACAGCAAAATCTGGGCCAGTACCGCTG
CAATGGAATCGGTCGCGATGGCAACGTTAAGACCTATTTCGTTAAAGAGCTGGTCCTTATGCCCCTGCCCCGAATCAGGT
TCTACCCGAATATTCCGCTGACCGTGGAGGCGGGTCAGAATTTGGATGTGCACTGTCAGGTGGAAAACGTGCGTCCGGAG
GACGTTCATTGGAGTACCGACAACAATCGACCACTGCCCAGTTCGGTTCGCATTGTGGGCAGCGTCCTGCGCTTCGTGTC
CATCACACAGGCAGCTGCCGGTGAATATCGCTGCTCTGCCTTCAACCAATATGGAAACCGATCGCAGATCGCAAGAGTGG
CAGTAAAGAAGCCCGCCGACTTCCATCAGGTTCCGCAGTCCCAGTTGCAACGGCACCGCGAGGGCGAGAACATTCAACTG
CAATGCACGGTGACCGATCAATATGGCGTAAGGGCTCAAGACAATGTTGAGTTCAACTGGTTCCGCGACGACAGAAGACC
CCTGCCGAACAACGCCCGTACGGATAGCCAGATCCTGGTGCTGACCAATTTGCGACCCGAGGATGCGGGTCGCTACATCT
GCAACTCATACGACGTGGACCGTGGGCAGCAACTGCCCGAAGTGTCCATCGACTTGCAAGTACTAACGGCTACCCCGCCA
CCCAACAGCCCCATCTACCTGCCACCGCAATTGCCAGCAAAGAGCCGCGACTATAGCCTCAAACTGGACGATCAGTCCTC
GAACCTGCGAGCGGGTGAATCCACCGATGTCGAGTGCTACTCCTCCGATGACACCTACACAGACGTGGTGTGGGAACGCT
CTGACGGGGCTCCACTCAGCAATAATGTCAGGCAAGTGGGAAATCGTCTGGTGATCAGTAATGTGTCGCCAAGCGATGCC
GGTAACTACGTGTGCAAGTGCAAGACGGACGAAGGGGATCTGTACACCACCAGCTACAAACTGGAGGTCGAGGATCAGCC
TCATGAACTCAAAAGCTCCAAGATAGTTTACGCCAAGGTTGGCGCCAATGCCGATTTGCAGTGCGGGGCCGATGAAAGTC
GACAGCCCACCTATCGCTGGTCTCGCCAATACGGCCAACTTCAAGCGGGACGCAGTCTAATGAACGAGAAACTGTCCCTG
GACAGTGTGCAGGCAAATGATGCCGGTACGTATATTTGCACCGCTCAATACGCCGATGGTGAGACTGCAGACTTCCCCAA
TATCCTGGTTGTGACTGGGGCGATTCCCCAGTTCCGGCAGGAACCTCGCAGCTACATGAGCTTCCCCACGCTGCCAAACT
CTTCGTTTAAGTTCAACTTCGAGCTGACCTTCCGACCGGAAAACGGTGACGGTCTCCTACTGTTCAACGGACAAACCCGC
GGAAGTGGCGACTACATCGCACTTTCGCTCAAGGATCGCTATGCGGAGTTCCGTTTTGATTTTGGTGGTAAGCCAATGCT
GGTGCGAGCTGAGGAACCACTGGCGCTGAATGAGTGGCACACGGTTCGTGTGAGTCGCTTCAAGAGGGATGGTTACATCC
AGGTGGACGAACAACATCCGGTGGCCTTCCCCACCCTGCAGCAAATACCCCAACTGGATCTGATCGAAGATTTGTATATT
GGCGGAGTGCCCAACTGGGAGCTCCTGCCCGCCGATGCTGTTAGCCAGCAAGTTGGCTTCGTGGGCTGCATCAGTCGCTT
AACTCTGCAAGGACGCACCGTGGAACTGATCCGTGAGGCGAAGTACAAAGAGGGCATCACGGACTGCCGGCCATGTGCGC
AAGGACCTTGTCAAAACAAGGGAGTCTGCTTGGAGAGCCAAACCGAGCAGGCCTACACCTGCATTTGCCAGCCGGGTTGG
ACTGGAAGGGATTGTGCCATTGAGGGCACCCAGTGTACGCCCGGAGTCTGTGGCGCCGGACGCTGCGAGAATACGGAGAA
CGACATGGAGTGCCTGTGCCCACTGAACCGATCCGGAGATCGATGCCAATATAATGAGATTTTAAATGAGCACAGTCTCA
ACTTTAAGGGCAACAGCTTTGCGGCCTATGGAACTCCTAAAGTCACCAAGGTCAACATAACGCTCTCCGTACGTCCGGCA
AGTTTGGAGGACTCCGTGATTTTGTATACTGCAGAATCGACTCTGCCCAGCGGCGATTACCTGGCACTGGTACTGCGTGG
TGGTCACGCGGAGCTCTTAATAAATACGGCAGCTCGATTGGATCCCGTGGTAGTGCGATCTGCTGAGCCACTGCCCCTGA
ACCGCTGGACAAGAATTGAGATCAGACGTCGCCTGGGCGAAGGAATTCTACGGGTGGGCGACGGACCAGAGCGAAAGGCC
AAGGCCCCAGGCTCGGATCGAATTTTGTCCCTTAAAACGCACCTCTATGTGGGCGGCTACGATCGCTCCACGGTCAAGGT
CAATCGGGACGTGAACATCACTAAGGGCTTCGATGGCTGCATCTCCAGGCTATACAACTTCCAAAAACCTGTCAATCTCC
TAGCGGACATTAAGGATGCGGCAAATATACAGAGTTGTGGGGAGACTAATATGATCGGAGGTGACGAGGATAGCGACAAT
GAGCCACCAGTTCCGCCTCCAACTCCAGATGTTCACGAGAACGAACTTCAACCATATGCGATGGCGCCGTGCGCCAGCGA
TCCATGTGAAAACGGAGGAAGCTGCAGTGAACAGGAGGACGTGGCCGTATGCTCCTGTCCTTTCGGATTCAGTGGCAAGC
ACTGTCAGGAGCACCTCCAACTGGGCTTCAATGCCTCGTTCCGAGGCGATGGGTACGTTGAGCTGAATCGAAGTCACTTC
CAACCAGCTTTGGAGCAATCCTACACTTCTATGGGCATCGTCTTCACCACCAACAAGCCGAACGGTCTGCTGTTCTGGTG
GGGCCAAGAGGCCGGAGAGGAGTACACCGGACAGGACTTTATAGCTGCCGCAGTGGTGGATGGCTATGTGGAGTACTCAA
TGAGGCTCGATGGCGAGGAGGCGGTAATCCGGAACAGCGATATCCGCGTAGACAATGGGGAGCGACACATTGTGATCGCT
AAGCGGGACGAAAACACCGCCATTCTAGAGGTTGATCGCATGCTGCATTCGGGTGAAACCCGACCCACCAGCAAAAAGTC
GATGAAGCTGCCGGGCAATGTTTTTGTCGGTGGCGCTCCTGACCTCGAGGTGTTTACGGGTTTCCGATACAAGCACAATT
TGAACGGCTGCATTGTGGTCGTCGAGGGCGAAACTGTGGGCCAAATTAATCTTAGTTCTGCTGCCGTTAACGGAGTGAAT
GCCAACGTCTGTCCCGCTAACGACGATCCACTGGGAGGAACCGAACCGCCAGTCGTCTGAGGACACAACCAACAGCCGAA
ACTAGCTTTTTAATTAAACATTAACAAATGAAACAAAACGAACAACAATTTTTATATATACAACATATGCATAAGCCCAA
GAAAATCCACAAAAATTGAATATTATATCACTTACACATAATAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0342806
14181
FBtr0342807
10611
FBtr0342809
12022
FBtr0342810
12866
FBtr0342811
11515
FBtr0342812
12232
FBtr0342813
12679
FBtr0342814
12540
FBtr0342815
11749
FBtr0342816
13776
FBtr0342817
12781
FBtr0342818
12294
FBtr0342819
13666
FBtr0342820
14232
FBtr0342821
12798
FBtr0342822
12900
FBtr0342823
13213
FBtr0342824
12378
FBtr0342825
12846
FBtr0342826
13488
FBtr0475303
13023
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0309644
4411
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0309642
4434
FBpp0309643
3105
FBpp0309645
3897
FBpp0309646
4176
FBpp0309647
3728
FBpp0309648
3967
FBpp0309649
4150
FBpp0309650
3887
FBpp0309651
3806
FBpp0309652
4299
FBpp0309653
4150
FBpp0309654
3805
FBpp0309655
4479
FBpp0309656
4451
FBpp0309657
3973
FBpp0309658
4007
FBpp0309659
2853
FBpp0309660
3833
FBpp0309661
3989
FBpp0309662
4203
FBpp0423412
4178
Comments
Transcript terminates at site supported by polyadenylated cDNA.
Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
trol-RAH
Secondary FlyBase IDs
    References (0)