Open Close
General Information
Symbol
Dmel\IPIP-RD
Species
D. melanogaster
Annotation Symbol
CG12393-RD
FlyBase ID
FBtr0343120
Feature type
Associated gene
Evidence Rank
Length (nt)
1213
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 21 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CATTGAAAACTAGAAATTCCGCACCCAGCAATCGATAACCGGTGGAGGTGTGGCAGCACTGGCCATCAGCTGTTCGCGCA
          GCGTCAATTGTTTCTCGCTTTGCATTTTTTTTACCTGTTCATCACAATAATAAGAGACGAAAGGCGGAAATAGGACACCC
          ATATTTGCTTCGAATGCAGCCCGAGACAGTGCAGCCATGAAGATCAACGAGAAGAACCTGTACGTGTTCGCGAGAACGCC
          GCCCTTCGACATGGAAGGCTTCCTCAACAAACGGGGCGAGGTCAACAAGGCCTTCCAGCGACGCTACTTCGTGCTGAAAG
          GCAACCTGCTCTTCTACTTCGAGTCGCGCTTGGACAAGGAGCCCTTGGGCCTCATCATTGTCGAGGGCTGCACCATTGAG
          CTGTCTAACGAGGTGGACAACTACTGCTTCGAGATCGCCTTCAACGGCAATCGCACCTACATCCTCGCCGCCGAAAACCA
          AGACAGCATGGAGACGTGGATGAAGGCGCTAACATGCGCCGGCTACGAGTATAAGCGCATCATCCTGGCCGAGCTAAAAC
          GCCAGTTGCAAGAGATGGAGGACGCAAGAAACAAGATGCTCGGCAGCGCCTTGGACGGACCACAAAATGCATCGGAGAGT
          GCGAAGCCTAGACCGCCGCCCAGGCGGACAAATCCATTCAACAGACCCGCTCCTCCTCCACCAGACAGTTCGCTGAGGGG
          CGGAGTAGTCATGTCGCCCCTGCCATTTATCAACGGATACTTCGGATCGAGCAACGCGCGCCTGCAGCAGGAGAAGCTAA
          TGAGCAAGCAAGACGCAAACGGAAACGGAAGCCCCAGCGGAACGCCCAGGGCCCAGCGCCGTCCCACGCCCGCTCCTGCC
          ATCGCGAACAGCGTCTTCTATCCCGATGTCCGGGATCCGGGAGCGGCCAACAATAATCACAGCACCGTCAACGGTGCTGA
          GCGCCAGCGTCGCCAGGTCAAAGCACTGGAGGAGTTCGCACGCAACCACGAGCGCTTTCGCAGGGAACTGATGCCGGATG
          TGTCCGCTTACCGCGAGCGCCAGGGTCAGCCGCTCATCCAGTTGTGATGTAGGAGTGGGCTGCTCCGACAAAAAGCCAAT
          GTATTACCCGTTTTGTGCTAAATCAAATACGTTTCAAATGAACTATGCTTAATTTCCATACATGTTTGTTTCAATAAACA
          AAACTTTAGATAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0079184
          1612
          FBtr0079183
          1700
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0309820
          296
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078815
          296
          FBpp0078814
          296
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG12393-RD
          IPIP-RD
          Secondary FlyBase IDs
            References (0)