Open Close
General Information
Symbol
Dmel\CG4882-RB
Species
D. melanogaster
Annotation Symbol
CG4882-RB
FlyBase ID
FBtr0343290
Feature type
Associated gene
Evidence Rank
Length (nt)
1626
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 73 )
Sequence
AGCAATTGTTGTGGAGTGCCCACCGCAGGGATTGGCGGTGAATACCTTTCAGATCTAATTAACAAGATCAAGATTGAATT
GCAGTTTATTGAAATCATATGTGCCCAGATGACATTTTCAATTCCATCGTTCCCGGAAAAAGCAACATATTATAAGTCGA
AATACCCTCAATGCTTTCGAATACGAAAATACCGCTATCTGCGGTATTAACTGGCGAACGCGCTAGGGATTTTGTTGCTC
TTTTGGCCAGCTGCATGTTATTTGTTAATCGGCTGGTTATAACACTTTATGAATTAAAAAAGACAATTGACAATGCTGCG
ATCGAGGATTTCCTGCGCACTGCCACCCAGGAGACTGGTGTCCTACTTCTCGGCGGAATTCAACAAGGTGGCGCACGAGG
GACCGGCTAAATTCGCCGCAGGCAGCAGTCATGCCGTAACGAGTGTGGATTTGGATGTGTTCGTCAATCCGGATAACCGT
CCCATGGACCTGGTGGACCGGCTGCTCAAGCTCAGGAAACAGAAGGAGGCCAGTTTGGTGCCGCTGATTCCCAGTGTCTT
GGTCAAGCAATTGCTGGACTCCACCAATCCGCAGGAGACGATATCGGTGCTCCGTAATCCCATCCAGTACGGGCTCTTTG
TGGACCAGTTCTCTGGCTGCTTCCTGTTGGACTTCCTGCTGCACAATGGCCACGCGGTGGAATCTGCCCAGCTGGCCACT
ATTCTCGTGGACAGAAACTTATGCAACAACGAGTTGCTGGAGTCCCTGGCCCTACAGTCCTTCTGGTCCTTCGCCAAGGA
GTTCAAGCCCTTCGAGTCCTCTCAAGTTCAACCTCCTGCCAAAAATGTTGAAGTGGAAAAAGTTCGCGTGAAGTTCATTC
GCAATTACCCCGACGACGCCAGCGAAAATACCGAAGAGAAGAAACTGGGTCGCGCCATGGTTCGATTGGGCTCCGGCGAA
GGGTCCTTGAAAGAGCTGAAGCAGAACGTTGCCCTACTTGGCTATGTCCTAACCGGACAAGTGCCCGAGGCCTCCAGCTT
TCTGGCCTCGAACTCAGCTGCCCTGCACAAGGAGACTCTTTTAGCCGCACAGAGCATAGTTGAAAGCCTCAAGCTGGAGG
GATCCGAAGAGCTGCTGAAGTCCCTGCAGGAAGCCGTTGAGAAGAGTAGCAAATCGAATGCCATTCAATCGCTACTGGAG
AACAGCGTCAAAGCCAATGTGCAGAAGTTTGAGCCCAAACTGCTGGCCGACTACGGCGAGTCGTATCAGGAGTGGGCCAA
GAAGTTTGAGGCAGCGGTGCAGCGACAACTGGATTCGCAGAGCGTGGAGGAGCGTAAGGCCACCATCCAGAAGACCCTCA
GCGAACTGGAGGCGAAGCGGCAGAACCTGTGGTTCTTCGAGAACCGGGACGACATCGACATCCAGATCTACAAGAAGAAG
GTCTACTATCCCAAGCGCTGGTTCGGCAAAAAGAAGAAGCCCAAGGCAGCAGACACCTTCTATGTGCCGCCGACTATCAC
GCACAACGGCTAGTGGACAACCCGTGGACCCACGACAACTCCTGGCCACAAACAAGTTAGATCCAATTGTTTTTAAGCTT
TAATTAAACTACTGGAGAGTTAATCC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0072225
1397
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0309955
406
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0072134
406
Comments

5' UTR based on RNA-Seq data.

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG4882-RB
Secondary FlyBase IDs
    References (0)