Open Close
General Information
Symbol
Dmel\CG7556-RB
Species
D. melanogaster
Annotation Symbol
CG7556-RB
FlyBase ID
FBtr0343313
Feature type
Associated gene
Evidence Rank
Length (nt)
2893
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 71 )
Sequence
CGACCAGTCTGCTGACGTTGCCACTTTCCAGCTGAGCCTATCCGTGTTTGCTTGCGTGTGTGTGTATTTGTGGTGCGTGC
GTGGGTCTGGCGCATTAAATTTGGATTTTACTCCGATTTGGACCTGACCTGGATTCGGAACTCGGACCACGATGATGATG
CGACCGGAGCTGACGCTGGCCGGCCTCCTGCTGCTCTGCGCCACTGGCGCCAGCGCCTGGCACTCGGAGGAACTGGAGAT
CTTTGACTTGGTCGAGGAGGTAAACCGCAACTTCTACGAGTTCATGGGCATCAACCAAACGGCAACGGGCGCCGAGGTGA
AGCGCGCCTTCCGCACCCTGTCCATTGTCCTGCATCCGGACAAGAATCCGGCCGAGGATGCCAACATCCAGTTCCGCAAC
CTCGTTTCCATCTACGAGGTTCTCAAAGATCCGTCGCGCCGAGAGAAGTACGACCGGGTACTGAAGGAGGGCATGCCCAA
CTGGAAGTCTGCCCTCTACTATTACCGACGTATGCGCAAGATCGGGCTCTATGAGGGCGCCTTTATCCTCTTCCTGATAA
CCACCGTGGGCCAGTATCTATTCGCCTGGGCGGCCTACCTCGAGAAGAAGTACACCGCCGAACAGGTCTTTGGCACCAAG
CTGAAGAAGCTGCAGAAGAAGAACAAGAACATCGACATGGACGTGATCCTTAGCGAGATACCGATGCCCTCGCTACTCAA
CACCCTGCCCATCCAGATCCCCTTGGCCCTGTGGAACCTGCCGCGCACCATCAAGAACGGATTCAGCAAGGCCAACGAGC
TAAAGGAACTCGCCCTGGAGAAGCGCAGGCAGGAACTGGAGGCCGTCCGTCGTCAGGAGGAACTGGAACGGGAGGCCGAG
GAGCAGGCGCGCCTTCGCAAGGAGCACAAGGAGAATCTGCGGAAGCGCAAGCAGAACAGCAAGGCTCCAGAGAAGACCGA
GGAAGAATTGCGCGGCTATTCGCAGATTCAGACTCGCGAATTGACAGATGACGATGCAGTTCGTCCAGCTTCCCAGAAGA
GCACGGTGAGCGGCGGCTTCTGGACTGACGAGGATCTTACCGAGCTGATTCGCTTGGTAAAAAAGTATCCTGGCGGAGCT
GGCAGCCGCTGGAACACTATCGCCGAGTCGATGAACCGCAGCGTTCAGGAGGTGACCTTTATGGCGGCCAAGATGAAGGA
GAATGGCTACCGCATTCCCGGCCAAACTGACAGCGTGGCCGAGGCTCTCGTCCAGGAGTCCCAGCAGGCGCAGCGTAAGG
AAAAAGTGAAGAAGGCAGCCGCAAATGCAGGAGCTTCAGCCGAGAAGAGCATGCTAATTCCGGAGACCAACTGGACGCAA
GAGCAGCAGCGCGCCCTGGAGGCGGCGATAGTCAAGTACCGGAAGACGGCCGGCGGAGACCGTTGGCAGAAGATCGCCAA
CAGTGTGCCGGAGAAGACCAAGGAGGAGTGCCTGGTGCGCTACAAGTATCTCTGCGAGCTGGTCAAGACGCAGAAGCGGG
CCGAGGAGGAGGCCAACGAGCCGGACGAGGATGCGGCCGCCATCGAGGAAGAGCTCCCCGAGGAGGAGCCCCTTGCGCCG
CCAGAACCGGAAGTGGCGCCAGCCGCCAAGAAGCTCAGCAAGCGGGAGCAGCGTCGCCGTAAGCGGGACTTATCCAGCGG
CGAGGACTCGGACGATGCATATCAGTACGAGATCAGTTAGTCGGAAACCCGGCTCCCGCTCTGTCCTCCTGCTGCGGCAT
CTCCTCGCGTGGCTCACAACTAGATGTAATTGAATTTTTTTATACTTTGCATTAAAGACTCTCTGGCATAGCATTTTGGA
CCTTGCCAATCCTAATCCGCGGCCCGATCCTCTGCCCCTTCCCTGACCTTCTGTTTCCATCACCGTGTGTAGCGCTTATC
TTATGTTTTGTACATAATTCTATATTGTAAACATCTAAATGTCGATTAATTCCTTTGCTAAGTAAACGAAATGTAAGAGG
AAGTGAATAGGATAAGAGTTTTTGATGGGTTTCTGTCAGGGATAAAGCCATCGATGATAGATACGGTGTACTTCCAGGTT
AGTAACTAATAAAATAAACATCAAAAGTAACAGAACTTGACAAAGTTAGTAGGTGCAACAGCATAGCCACTACATATACA
TAAATCATAGAAGCATTAAATACATTCATACAATATTAAATCAATTTATTATGTACACAAACGCGAATGGTTAATTATTA
TTATTGCCTTTCTAAACCGCCATTCGCAAAACGTATCTTTTATGTCAATTGCAGCTTTAAAGCCATCAAAGTCAAGCGCT
AACCAATTATAATTCCCAGTTGGCTTGAACCTGTCAGCCGATCAAAGAGAAGTTTCCCTTTCAGATTTATTATTAATCAA
AACTAAGTTAAGCACTTTCGGCGGTTCTTGACGATTTTTGGAAGCCCGCGACTAATCAAAGATACCAATTCATTATTAAT
GTGGCTGGCAGGCGGATTATTATGGGGTTGTGTGTGTGCGGATAACCTTGGAACGATTGGCTTTTAATTACGCTCGCCTT
ACATTTGATGATTATTGGACTATGACTGTGACTCTGAACGGCGTCAACTCCTCGCTTTTGGTTGCCCAGTCCGGTTGGAT
TGCTTATGGCCAACTCGATGCGTTGCCTCCTCCCAATTTGGTCACCCATCGAGTTTGCATTGAACTTAAAACGCTTGTGC
ACTAGAATCACCAGACTGCGTCAACAAGACCCACAACCAAGATCCAAGACTCCAAACTCTAGACTCCGCGAACTCAAGTG
TAGGCGCAGCAGAGCTCGTCAGACTGTCCACCACGAAAGCTGGTTGAATTCGCTTGGATGACAACTGGAAAACGAATTGC
GAATTGAACTTCC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0074697
2005
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0309972
522
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0074466
522
Comments

Extended 3' UTR based on RNA-Seq and/or EST data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG7556-RB
Secondary FlyBase IDs
    References (0)