Open Close
General Information
Symbol
Dmel\RpS28b-RB
Species
D. melanogaster
Annotation Symbol
CG2998-RB
FlyBase ID
FBtr0343411
Feature type
Associated gene
Evidence Rank
Length (nt)
972
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 318 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CTCAACTTCCTTTTTGCTTGCGGCTGTCAATTGAAGCGCATCTTGCACGTGAATTCTCTGCGAATTTAGCATTTTTAGCG
      ATCTAACATGGACAAACCAGTTGTGTGGGCACGCGTCATGAAGGTTCTGGGCCGCACCGGCTCCCAGGGTCAGTGTACCC
      AGGTGAAGGTCGAGTTCCTGGGCGAGCAGAACCGCCAGATTATCCGAAACGTGAAGGGACCAGTTCGCGAGGGCGACATC
      CTGACCCTTTTGGAATCCGAACGTGAAGCCAGGAGGCTGCGCTAATTGGCGACCAAACTCGAGAAGACCTTTTTACACAC
      ACATACACAAAACTGTTTTTCGCACGCGCCTTGTTTTTTTCGCGGAGAAGAAGAAGCGGATGGCAAGAAATCCGAACGAG
      GCTGCTGCATATTCGTTATAAACAAATGAAAATACACACCTAATTCGCCAGAAAATCAGCAAAAATGTGTTTTAAATAAA
      TCTCGAGAGCATTGGACCGCCTTTGTACGAAAAGAAAACCAATCAAGCCTGTGTTTTGGTTTCATTACCTTTTTTGTTTC
      TGTGTTTTTTTTGAGTGCCCAGTGAAAATTGACAATGGAATGTGGTCTTCAAGCGACTTCCTTTAACAATATGTATTTGC
      ATTTAGCAGAAACCCTTGCCTTCTCGGAAATCAACAAAGAAAATACAGACGAAATTCTCCAGTTGCTAAAAACACGTTTC
      GTTGATTTCCTTATAAACGCAAAGTTTTTCTGTTAAACACAATGATCAGAAGTTCTGGACACGTTAACATCTTAAAAAAA
      ATGTTTTATTTTTTCGTCCACGAAAAGATATTTCAAAGAGAGGCCAGCCGAGTGATTATATAGCCCAATCACATTTCAGA
      TTTGACAATCAATGTTAATGAATGCACAGTATTTTTTGTATAAAAAATAGTTTAAATATTTGAACTGCTGGAGCTGCACA
      GAAAATATACGT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0071360
      520
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0310057
      65
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0071295
      65
      Comments

      Extended 3' UTR based on RNA-Seq and/or EST data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      RpS28b-RB
      Secondary FlyBase IDs
        References (0)