Open Close
General Information
Symbol
Dmel\CG44838-RI
Species
D. melanogaster
Annotation Symbol
CG44838-RI
FlyBase ID
FBtr0343558
Feature type
Associated gene
Evidence Rank
Length (nt)
3758
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TGTGCGCTGCGGCGATGTTGTGTTTTCTCACGGCGGTGAAAACACTCTGCGACGACTGTGACAACAACAGCAACAACGAT
        AAGATTTTCCGTTTTTCCGTATGGAAGCAGAAGCACTAGCGGCATTTGTTTTGAAAGTAAAGCAAAGGCAAGCGAGAAAA
        ACGAAAATATAAAGCAGAGGAAGACGGAAAAAGCAACGCCGCTGCCGACCGCGCCTCGCTCTTTAAATAAATTATAACGT
        ACAGTATTACAAAAAAGAGAATATCAAAAAAAAAAAGCAAACATATAACAATTGAACAAAATGTCCTGCATATCGAGCAA
        CTTTAGCTCCTTCTTCCTCAACTCGCTCAACGATCCTTCAGAGTTTTCCAAGTACTTGAGCAATGGCGAGCTCAAATGCA
        CTAATTTCGAGGAATTTCAAGTGTTTGGCTGCGGCGCAGGCGCGGCGACGCAACAACAGCAGCAACAACAACATCAGCAG
        TATTCCCACACACATTTACCCAATGGCAGTTCAGCGACAGCAGCAGCGGATTTTCCCAATTACGAGGCAACTACAACGCC
        GCAGCGGGAAAACTCCTCCTCCGTTAACTCAGGTAGTTCTGTTAATCCCGCACACTATGCTTCCGCCGCTGCCTCTGCCT
        CTGCCAGCGTCGAAGCCAGCGCATCAGCAGCACCGACGTCCACTCCAGGAATCGCAGGAGCAGCAGGATCAACTTCCCTC
        ACCGCCACCCCCTCGAGCAATCGCTGGCCAACTGCAGTGGCCACGCCCAATGGCCATCAATCCACCGCCTCGACAGCGGG
        CTCAGTGCCCCAGCACTTCGATGGATCCTTTGAGTTTATCAAATATCTGCGACACTCCACGGACTTTACGCCCAGCACAC
        CGAGCAGCGCCACCGAAACTAGCTCGTGTGCGGAAAAGCAGGTCAGTGTCAGTAAATCGGGCGTCCAAGCAGGCGCCACA
        CCACCACCGCCTGCTCAATCGCCGGTGGCCGGTGGTCTGATCGATTTGGATACTAGCACCTCGCAGAAATCACGATCTGC
        CTCCCGCAAAGTGGCAGCTTTGTTGTCTTCCGTTTCGCGGGCTTCCAATAGTCTGGTGGACACCAGCTCCTCCGCTCTGG
        ATGTCTTCGATCACGATTCAAAGCAGACGATCTTTGATCTACAGCACATTGCATCAAACGGATCGTCCAATTCGAATGAA
        TCTTCGCTGGAAATGCTAGCATTTCCCAATTCGCACCTAAATGCCTCCAATTCGAACACCTCATCCGAAGGAGCAGCCTG
        CGGAAGTGCGGGAGAATTCGGAGGATTGTTAACCGGCGCCAGTTGCTCCTCCTCCACGGCTTCGTCGTCTTCGCATGCAC
        CGAAACTCCTCGGAAGCTTTGTGATCAAGGAGAACTTCGAAGTGCATCCGTCGCACAAAGTGGAAGAGGGCATCTTCCAG
        CACATGAACAAGCTGCCATCGAAGAAGAAGGATACGCTAAAGCAGCTGGGAGTTCGGTTCACCGGCCAGATGACGCTGAC
        GGACAAATCGATTGTGGTGGAGAACTTCATCAAGTTCTGCGAGGAATACGACATCAAGGACCACAGGCCATGGCTGTCAC
        TGAATCAGTGCGGTTTGAATAAGCCGGAGCAGATCAAATTCGCTCGATATCTGGGCCAGGGACTGCCGACGTTTACGCTC
        TTCTGCATTTATAGCAATTTTAAGAATCTGTTCTGCACCAAACGCACGGAAATCTACACGAAGGATGGCTACAATCTGCC
        TTATATACTCGACAAAACCAAGCGCTTTCTGGCCAACACAACAGCTGACCTCAAGAACATGGCGGCGGCCAACGATGGCT
        CCCTGGAGTTCGCCACCGGCAGCGGCGGCGGCAGCAGCAGCAGCAACAACAGCAACACGTGCAACATGAACATCGGTAGC
        AACAGCAACAGCAGTGTCAGCAGTGGCAGCAGCAACCCAGTGTTAGTGCCAGGATCGGTGATTAATCCCAATGCCGTGAC
        CATGCCAGCAGGCTATGTGACATCATCGACGGCGCAGCAACAGCAGCATCAACATCAACATCAACACCCGATGACCATGG
        ATCCGCGCTACGGATGTGGAGCTCCACCGGCCCTATTGCCTCCACCGCCGCTTCCGGCACTGGGACCACCGCCCAGATCG
        CTGGAGCAGCTAATCATCTACGAGAACTTCGACGTGCACGAAACGCACCGGATCGAGGATGGGGTTTGCACTCACATTAG
        CCGCCTGCCGCCCAAGAAGCAGGAGCTATTGAAACAGTTCGGTATACAGAGTAGTAGCCAGCATTGTCTGAGCAATTATG
        AAAAGTACATACTCATCGAAAACTTCATCAAGTTTTGCAATGAATATCAGATATCCGATCATCGACCCTTTTTGGACTTC
        CACGAGAGCGCTTTATCCAAATGTGAACAACTTAAATTTGTACGATATTTGGGCCAGGGGCTATCCAATCTGACGCTAAA
        CAAGATCTATGTCGCCTTCAAGGAGCTACTGGGCAATGGAAGGCCCGAAAAAGCTGGCATGGAGAGCTATAATTTGGACA
        CCCTGTTGAAAAAGAAACGAAAGAATCTATATAATCGTATGCATGCCGCTGCGCCCAGCATTGACCTAACTGCCTATGAA
        TCGGGACAGCATAATGCCCAAGCACATCTGGCCACGCCACGCCCACATCACGCCTTCGCCGCCCTAAATGCTGTGACGCA
        GCGCAGCGAAGTATGCAACGAATTGACGCACACGGGATTGCAGTACAGTTACACCGGACCCCGGTAGAAATTGGCATTAT
        CATATAGACCCCATCCGAAAAACAATGCAATCCTCATCGGCAGATGAGAGCCCTCACACACACACACACACATACACACG
        CATATACATATACTTCTTCCTGGAACTGGACCAGTAACTGTTGTGTCTTCGAAACATAAAAATGAGAGTAATTTAATCGC
        CGCGTGCGAAATCATTGAAAACTAAGTGCTAAATTAAATGAGCGGGAGACAAACAAAATGATGTCTCCCGATGGATAACT
        ACCAGACACTAGTAAAATTAGCCTAAATGTTAACAAAATTTAACTTTAATCGAATAAAATTCAATTAAGCCAACCAGATA
        TCAACACGACGCAACAGGCAGGAGAAAGATTAGTTTAAGCCAAATTCAGATATTTATACGCAAGGTAACCATATACAACA
        ATATACATATTACGAGTATATATATACATACACACACATACATAAATATATTTCTGTAGTTGCCATAGCGCTTAGAGGGT
        GCAGCACACTTCCACATGGCCAAATCCTGGCCAGAACTCTACAAACATATTAGCTTCGGTTTCCTTCCAGCCCAGCCATA
        TCCCCCCCCCAACTAAAAAACCGCTCCCAAAACTTTAGCCCCAAAATGAGCTGCATTAGTAGTAGCGATTAGCTGATAAG
        TGAAAACACCAAAATTGAGAATACTAAATCAAAGACCTCCCAATGAAAGTTCCCGAAATACGCATACTAAGTAACATGTA
        GAGCCTAGTTTTTAAGACGAGATACAAATTTTTAGCATAGAACTGGCGAGCGGCACAGACGATTAACAAACTAAATATTC
        CTATATACAATATACATATTATATACAACAAGCGCAGCATCAAATTCAAAGTGAATATACGCAAAAATCAAATGCAAAGA
        GGCAGAAGAATACAACCAAAACATAGCAATTGTAAATTATATATACCAAATATATTCTATACGAACAAAGGCAAAACC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0343555
        4766
        FBtr0343559
        5524
        FBtr0343560
        3089
        FBtr0343556
        5029
        FBtr0343557
        3263
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0310159
        828
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0310156
        783
        FBpp0310160
        828
        FBpp0310161
        783
        FBpp0310157
        783
        FBpp0310158
        783
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG44838-RI
        Secondary FlyBase IDs
          References (0)