Open Close
General Information
Symbol
Dmel\CG44838-RF
Species
D. melanogaster
Annotation Symbol
CG44838-RF
FlyBase ID
FBtr0343560
Feature type
Associated gene
Evidence Rank
Length (nt)
3089
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 55 )
Sequence
AGAAAAACGAGAGAAAATTTCGAAATATCGCATGTGCCATTTTAAGCTTTAAATAAATTATAACGTACAGTATTACAAAA
AAGAGAATATCAAAAAAAAAAAGCAAACATATAACAATTGAACAAAATGTCCTGCATATCGAGCAACTTTAGCTCCTTCT
TCCTCAACTCGCTCAACGATCCTTCAGAGTTTTCCAAGTACTTGAGCAATGGCGAGCTCAAATGCACTAATTTCGAGGAA
TTTCAAGTGTTTGGCTGCGGCGCAGGCGCGGCGACGCAACAACAGCAGCAACAACAACATCAGCAGTATTCCCACACACA
TTTACCCAATGGCAGTTCAGCGACAGCAGCAGCGGATTTTCCCAATTACGAGGCAACTACAACGCCGCAGCGGGAAAACT
CCTCCTCCGTTAACTCAGGTAGTTCTGTTAATCCCGCACACTATGCTTCCGCCGCTGCCTCTGCCTCTGCCAGCGTCGAA
GCCAGCGCATCAGCAGCACCGACGTCCACTCCAGGAATCGCAGGAGCAGCAGGATCAACTTCCCTCACCGCCACCCCCTC
GAGCAATCGCTGGCCAACTGCAGTGGCCACGCCCAATGGCCATCAATCCACCGCCTCGACAGCGGGCTCAGTGCCCCAGC
ACTTCGATGGATCCTTTGAGTTTATCAAATATCTGCGACACTCCACGGACTTTACGCCCAGCACACCGAGCAGCGCCACC
GAAACTAGCTCGTGTGCGGAAAAGCAGGTCAGTGTCAGTAAATCGGGCGTCCAAGCAGGCGCCACACCACCACCGCCTGC
TCAATCGCCGGTGGCCGGTGGTCTGATCGATTTGGATACTAGCACCTCGCAGAAATCACGATCTGCCTCCCGCAAAGTGG
CAGCTTTGTTGTCTTCCGTTTCGCGGGCTTCCAATAGTCTGGTGGACACCAGCTCCTCCGCTCTGGATGTCTTCGATCAC
GATTCAAAGCAGACGATCTTTGATCTACAGCACATTGCATCAAACGGATCGTCCAATTCGAATGAATCTTCGCTGGAAAT
GCTAGCATTTCCCAATTCGCACCTAAATGCCTCCAATTCGAACACCTCATCCGAAGGAGCAGCCTGCGGAAGTGCGGGAG
AATTCGGAGGATTGTTAACCGGCGCCAGTTGCTCCTCCTCCACGGCTTCGTCGTCTTCGCATGCACCGAAACTCCTCGGA
AGCTTTGTGATCAAGGAGAACTTCGAAGTGCATCCGTCGCACAAAGTGGAAGAGGGCATCTTCCAGCACATGAACAAGCT
GCCATCGAAGAAGAAGGATACGCTAAAGCAGCTGGGAGTTCGGTTCACCGGCCAGATGACGCTGACGGACAAATCGATTG
TGGTGGAGAACTTCATCAAGTTCTGCGAGGAATACGACATCAAGGACCACAGGCCATGGCTGTCACTGAATCAGTGCGGT
TTGAATAAGCCGGAGCAGATCAAATTCGCTCGATATCTGGGCCAGGGACTGCCGACGTTTACGCTCTTCTGCATTTATAG
CAATTTTAAGAATCTGTTCTGCACCAAACGCACGGAAATCTACACGAAGGATGGCTACAATCTGCCTTATATACTCGACA
AAACCAAGCGCTTTCTGGCCAACACAACAGCTGGCGACAATACCAACAACAACATCACCAACAACACCAGTAACAAGACC
AACAACAACACCAGCACAACAACAACATCCACACCGGTCAAACAGACACCACAACAACAGCACCAGCAGCAATCCGAGCA
GGATCCGCTGGCACCCAACTCACCAGCAACACCGAAACTTGCAGCAGCAGCCGCATCAGCAGCGACGGCCACGCCAGCAA
CACCAGTGGCAACATCGATGCTAGGAGCAGCCACGCCGGCACAGGCAGTACCACGCACAAGGCCAGCCACGCCCACAATG
CCAGCAGGAGCAGTAGCTGGAACGCCTACGACCCCACAGCACCAGCAACAGCAGCACCTGCATCAGCAACATCAACAGCA
GCAACAACAGCAACAACAACAGCAGCAGCAACAGCATATGTTGCAGCATCCGCACACGCACCCGCATCCGCATGCCCAGC
ACTCGCATCCGCACACGTTACCCCACTCACTTCCGCACCACCTGCAGCCTGGAACGCCAACGCGCAGTTCGCATCCCCAG
CTGCAGCATCCGCATCACTATCCACCATCGCCACACTCACATCCGCACCACCAGACGGGGCATCATGGTCTTCCACATGC
CCATCACTTTGCCTATGCCCATGGTCATCCGCATCCGCAACAGCATCATCCGCACTACTATCCGCATCCCCACGCACATG
TCCAGCATATGGCGGCGATGGGATATCCGGGACCACCACCAAACGCACAGCAGGCGGTTGGGGGAGGAGGTGTTGGTGGC
GGAGGTGCTGGCGGAGCAACAGGAGGCGCTGGATCCGCAGGAGGAGGTGGCGGGCCATTGCCGCCCACGGCCATGTGAGA
TTGGGGTCGGCGTGGCGCCAAGGACAGCGGTGGTGGCGCCACCTGTTGACACGCATAGGCTGTTGCAGAAGGACATGGCA
GAGGATTCAGGATTTCGGCCCATCCCCCATCATCCTCCCAACCTGTCCTAGATTATAGTTTTCCGTTGATGTGCATCGTC
ATATTAGTTTTTTAGTGTGCTCCTCGTTTTTAGTTTATGTTTCGTTTATTTAGACTAATTTTACACAAGCTTTTTGCCAA
ATTTTATAAAACTATGCAAATTTTGTATTACGTTTGACGACGATAAAATGAAATTGTTGTACAACGATCGATCATTACCC
CAAAACTATGCAATGTTATTCCTTGAAAAGAGATTATTACATTTACACACAAACATCACACATTTACACACTCACCAACA
CGAACGACACGAGTATAGAAAATCATGCTAATGCTATTTAATATGGTAATATATAAATATATATTTTAGTAAGCCAAGAA
CAAATGATATGTATGTTAATGTAAAACCAATCCTAACTAAACACAACATACGATATACATACATATATATGGAAATTGTT
TGCGAACCCAGAAAATATATATACACAACTAGCAAGAAGCGATTGAGAG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0343555
4766
FBtr0343559
5524
FBtr0343556
5029
FBtr0343557
3263
FBtr0343558
3758
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0310161
783
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0310156
783
FBpp0310160
828
FBpp0310157
783
FBpp0310158
783
FBpp0310159
828
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG44838-RF
Secondary FlyBase IDs
    References (0)