Open Close
General Information
Symbol
Dmel\Nup160-RB
Species
D. melanogaster
Annotation Symbol
CG4738-RB
FlyBase ID
FBtr0343613
Feature type
Associated gene
Evidence Rank
Length (nt)
4404
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 41 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GTAAGCGTTTTCCAACACTACTACTGAGCGTGTTTACGCCGGTGCCGCCAATAATTTTCCGTTTTCGTTGAGGTTTTTAT
      ATTAATTTGTTGTGCTAGCAAGATGCCCACATCCAAACTGCAAGCCAACATGAGCTACCGCGAGGTCATACCGCGGAACC
      TCAGTCCGGCGGAGTGGATCGAGGTGAAAATTAACACGGGAACCCAGAGCACTTTGCAGGATTTAAAAACCTTCGAAACC
      TCCGGCGGCTATTGCTACAAGAATACGAAAAATGTTCAGACCAGAAACCGTTTCATATATTGGCGGACATACCAGGATGT
      CCTGGAACTATCAGAGGTTAGTTTGGACATCTCCCTGCAGAGGAATCACCTGCGTCTGCGATTCACCGACTCCGCTGTGC
      TGAATGTATCACTCACGGAGCAAGGTACATCCGTCACCCTGCTGGTGGTCACGGTCAGCAGTGTGCATCGCTATGTGTTT
      CCCTTGAAGGTCGCTGGGCAGGAAGGTGGCGCAGCTTCTCCAGAGGATCTGCTATCCCAGTCCATTTTCTACGACGTCAA
      TGACAAGATCAATGATCCCAGCACTTACTATGTCACGGATGGCTTTGGAACTATGCCCAACGCGGCTGTATCGTACCTCA
      CTCAAGACTCCCAGTCAGCCTACTTTGCGGTGGCGTATCAGAGCAAACTACTGCTTCACGTTATGAAATGCTCCACCGGC
      CATACTATCACCCACGAAATCAAGGAGCCGAAGCTAATGCCATGGTTTCTGTCGAATCTCAAGGGTGCCCTCACCGGCCG
      CTCTGAAACGTTGGAGGCAGCCACGTCCATGGCTTTCAGTGAAATCGGGGGGGAAATTTTCATTCTGGTTCTGTATCGCA
      ATAATGAGCTGCGTCTATGGTCAGTGGATAACTTGCAGACTGTAGCCAGCATTAACTGCTCCACCGAACTGGGACAGGAC
      TCAGCAGCTCAAGGACCACAAAACAGCCAGCTCCGAAAAATAAGCGATCAAAACTTCTGTCTATTTCTCTCGCACAATTC
      CCGAGCTGAGTTTATATGCGTTAGCATAATGCCCGATGCCGACGATGCCAGCGTTATCAATTTGGTGCAGAACATGGTGC
      CGGCGCCGCAAACGGATTTGGTCGACTTCGATGCCACATCCTCGCACATCTGGGCCCTTTGGAGCAACGCTGAAGGCGAT
      TTCCATGTCTCGGCAGCATATTTTGCCTCCAACAACGCAATCAAATGGGTTTCGGCTGCTCTAGAACCGCCACCGGATCG
      GTATTGTCTCACCATGGAGCAGGGAGTGGATCCACGCGAAACTTACTGCAGCTATATATTTCATCCTGGTCGATTTGACC
      GAAATGTAATTGCCAAGGCTTTATATATGTTCAGACGCGTTAACCTGCAATTCGATGTAAAGCAACTTTCCATGTCAGTG
      CTCAAGGAGCAGGTATGCCAGGCCGTGGAAGATGAAATCCAAAACGAACTGAAAGACTTTGTGGTCACCGATGAGGAGTA
      CTTGGAGATATCCACTCGGCTGTGGGATCGCTTTTACTCCTGCTGCGAACAGTATCACATTAAGCTTTCCGAGCCGACAG
      GACTCGCCGTTCTTGGTGGAATGGATGCAGTATGTTTGGTTAGAAGGCAATCATTCGCATTGCTGCGCCCCTGCGAAGTG
      CTCGAGCACCTGTTGCTCATCGGCGAGCATAACGATGAAGTGGCGACATATGTGGCGCCACTATTTCGCAACGATCCCGA
      AATGGCCAAGGGTTTTGTGGAGCTCATGAATGTGGTGACACTGCTTGATAAACTAATTTCGGAGGACATTAAAATCGAGC
      TAGATAAACAGCTTTACCAGCGGGAGTCACCGGTTGAAGTAATATCTAAGCTGGTGGCTAGAATCAGTATGATCGATGAT
      AATGGTCCAATATTGCCATCAAACTGTGTGAGGCAAATCCAACAGAAGCTGCAGAATATACCAAATCTTGAACCCGCTTT
      GGAAATGCTGCTCGATGTGCTGTGTATGATTGATCCAGATGAACCGCCGCATGATTACTCCCTTTCTACGCGCTTCTTGC
      AGTCGTCTGGGGCTCTAATGGGTAGCGAATATGGACTTTCTATTTTGTCCGAAACAGTGAAGCAAATGGCAATGATACGG
      TTTTCTGTTTGCCGAAACCTTTTGGTATTGCAGTACATGGCTTATGGTCAGAACGAAATGGAAAGCGAAAATGTTTTAAC
      AAATTTAAATTATTTGAACTCATATTATACACTGGTTTGGATTGCCGAGACACCCATTTCATCGAGTACCCCAGCTGGAT
      TCGAGGCATCTATTCAACGATTGAGCCGCGCCCAACTTTTCAGCGGCTATAATCGACCATACTCCAGCCATCTGAAACAT
      AATGGGAACGATCAGACCACTCTGCTCCGACTGTTCCTGGAATCGAAAGGTCTGTTCAGCGCCTTGACTATGCTGCTGAA
      GCATGACAGTTTGTCGCTGGACTCGGAGCAATTGAATCTACGCCAGTCTTTGCTCCAACTTGTTGGATACATCAATAAGA
      TGCTTTGGCCGGGATCTCCGATTTACGTATTTCCGGAATGGTTATTTGGGACCTGTCATCACATCATTGTTCAGGATTAC
      GTGCGCATTTTGTCAAACTGGTGTTCCGTACAAAAACATGCCAGACGCTTTATGCTAGCCGTATCTCTATTGGATTGCGG
      TGAGGCCCACAAGGCCGTGCATCTCTTTCACGAGGCGGAGTCTGGCATTGTGGAGGATGACTTCCTCTTTGAGCATGTAC
      TGAAAAATACCCCTCTATACGGCAAATTACAGAATAGCGTCAGCCGTGGCGATACAATTTCCCCCGAAGACACAAAACTG
      GCAATTGTTCACTACTATCTTAAGGTTATCCAGCTCTTTGAACAGCATTCCGCATTGGACTACATTATTCAACTGGCTGA
      CATGGCCATTAGGGTGCTGCAGCCAGATGATCCTCAGTTGCCCATGTTCCAGTCAATAGTGTTCAATAATCATCTGCAGT
      TGGGACACTACGTGGAGGCGTACACCGCCTTAGTCAACAATGCAGATATTTCAAGGCGTAAGGATTGCCTTCGCCAGTTG
      GTCATAACGCTGTTCCAGAATAAATGTCTGCCACTGCTTATGCAGTTCTCCTACATCGGGTTGCAAGACGAGTTCGAGAG
      CATTGTTGAATCCCGGGCACGATCAATGAGCATCGATCAGAACGAAGTCTACAACTTTTTGTATGCATTCCATACGAACA
      AGGGTAACATGAGAAAAGCTTCTACGGTTATGTATGAGCAGGCCATGCGGTTTCAAGTAGACAGCGATGCACCAAACGCG
      CTAGAGAAACGTTGCTCCTCGCTGTTAATTTGCCTAAACTGTTTGCACCTAGTTGACAGCCGCTACAGATGGATTGCCAA
      GCCTGTTCTTGGTGATGAGCAGGTGATTACCATAGATCAGGATAACGACGATGGTGAGCCCAAATGTGACGAGGACAAGA
      GAGGCCAGGAGGTGGTTGTTCTAGAGCTGGCTGATATCCGAAGGGAACTGGTGCACGCAGAAGCTTTACGTGAGCTTTCC
      TTCTACCGCAAAGATACAGCTGCCTACGAGCGGGCCACACCCGAGGAGCTATCATACCTGCTGGCTAGTTCCGGCCTGTA
      CACCGCGGCATTGAAACTTTCGCGGGGACACTCGTTCTCTGTGCTCCCCATATTCGAGAGTCTGACATCCGCTTGTGTTG
      CTGCCACTGAGGACAAGTCGTCGGACGCCTGGAACTGGCTGCAAAACAACGACATGGCAGATCTACCTCATCGAAGTAAT
      GCTGCCGATATGGCCTGGACTTTACTTCAAAAACTGGTTGTGGATAACGAGGCAAAAGACTCCACCTTGATAAGAAAGAG
      CGTGGTTCAAAGGCTTCTCGGGTTAAACGCCTTCTTGCCCCAGTGGCTGATAAACTCCTACAAGTTATCCCACTCCCGGG
      AACTGCTCCACTTACTTGTGAAACACAATCGTCTGCTGGAAGCCGCAGATCTGGGATGTGAAATAATCGCCGGCATGCTG
      GGAGCAGGTAGCGAGTATTTCGAATTCAAACACGCGGTGAACATAGCAAACCCACAGCTCTGCTTCCCCATCAGCACGAT
      CGATTTGCTGCTGCACGGTTTAAAGATTAATGGCAAGGATGATCTTGATTATGAAATGGCTTACTTTAAACTCGAAGAAG
      AAGTTCAAAGATATATTGAGACCATAAAGCGCACCACCGATGATAAGATGAGCATGGCCGTTCTGCAGATGCGAACGGAT
      CTTCAGGAAGAACGTTAATAGTTCGTTTAAATCAGTTTATTTAATAAGTTTTTTGAATTAAATGCTAAAGCGTGTAAATC
      GTTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0080199
      4747
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0310208
      1411
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0079788
      1411
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Nup160-RB
      Secondary FlyBase IDs
        References (0)