Open Close
General Information
Symbol
Dmel\Ca-β-RO
Species
D. melanogaster
Annotation Symbol
CG42403-RO
FlyBase ID
FBtr0343615
Feature type
Associated gene
Evidence Rank
Length (nt)
4982
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            GTCGGTCGCATATTCAGACGTCTCCACCGCGAACCGCTTGAAACTGCTCCACATTGCTTTGCCCAAGTGGATCACGCCCT
            CGGAACATAAATCCCATCAAGCATATAGATTCCAGCAGGATGGCGTTGCGTTCGTTCAAATCGCTGCCATGTGACGGACT
            CTAAGTCCCATAGCCACATTTGTGACCCAATTCGATGAGCAATTGTGTCTGTGTGCCTGTGTGTGTGTGTGTGTGTGCGG
            GGCTCTTGGCCATTTAACGATTAGTGGCCATAACGGCAAAGTGTTTGTTTATTTTGTTGTGCGACCGCAGAAACGATTCC
            AAAAATGATTGCATAATTGACTTTTGGCGGGGGGGTGTAGAAATCGCGCTAGACGCTCAGCATAAATTTCGGCTTGTGTT
            CCTATACCGTTTGTGATTCCAAAACAATTTGTGAGCCATGAAAAAGCTTCATCTGGGTGCCAAGCACAAGGGCAAGTCCT
            ACAAGCCCTTTAGGAATAAGAATCGTCGGGGTTCTGCCGACTCGAACTACTCACAACCGTCATCCGATCTGTCGCTAGAC
            GAGGAAAAGGAATCGCTTCGGCGAGAAAAGGAACGTCAGGCCTTAAGCCAGTTGGATAAAGCGAGGAGCAAACCAGTGGC
            GTTCGCTGTGCGAACCAACGTAGCATACGATGGCGCCATCGACGACGATTCGCCGGTGCAGGGCGGAGCAGTTTCGTTCG
            AGATCCGGGAATTCCTGCACATCAAAGAGAAGTACGACAATAACTGGTGGATCGGCCGGCTGGTCAAGGAGGGCTGTGAT
            GTGGGCTTCATACCCAGCCCCGCTAAGCTAGACAACATTCGCATGCAGAACCAAACCAGACCCTCAAGACTGTATGGCAC
            AAAGGGCTCGTCGAGCGGGAATCTTGGTGCGGGCGGACAAGCAGGTGCGGAGCCATCTCGAGATTCCATGGGACCAGGAC
            GACACGGCAAGACACCGGCGGCGGCGGCCAACAAGGAGAAGCGAAAGCCATTCTTCAAGAAACAGGAGACGGCCAGTCCC
            TACGACGTGGTGCCCTCGATGCGTCCCGTCGTCCTGGTGGGGCCCAGTTTGAAGGGCTACGAGGTGACCGACATGATGCA
            GAAAGCCCTCTTCGACTTCCTCAAGCACCGCTTCGAGGGCCGCATCATCATCACCCGGGTGATGGCCGACATCTCGCTGG
            CCAAGCGCTCCATCATGAACAATCCCTCGAAGCGGGCCATCATGGAGCGATCCTCCAGCCGGAGCGACTGCCTCGGCAAG
            GTGCAGGAGGAGATCGAGCGCATCTTCGAGCTGGCCCGCTCGCTCCAGCTGGTCGTGCTCGATTGTGATACAATCAATCA
            TCCGTCACAACTAGCGAAAACTTCATTAGCGCCAACAATAGTGTACTTAAAGATTAGTAGTAGTAAGGTTTTACAGCGTT
            TGATCAAATCACGTGGCAAGTCGCAGGCGAAAAACCTCTCCGTTCAAATGGTTGCCGCCGAGAAGCTAGCCCAATGTCCA
            CCGGATATGTTCGATGTAATCCTAGACGAGAATCAGCTGGAAGACGCCTGCGAGCACATTGCCGAGTACTTGGAGACGTA
            TTGGAAGGCCACCCACCCGGACATTCGAGCAGTGCCGCCCATCGCCCGCCCCCTGCCGCAGGAGGCCTCGCCCTCCGCAG
            ATCCCGCGCGTCTGGGACCGACGCCTCCAGCATTCACAGCACGTGACATACCCGGTCCCTTTACAACAATGCTATAGATC
            AAAACGAGTTCAAATCTAAATCAAGCACCACGACCAACACAACTGCGACATCAACAGTACAAAATGCCAAAGACAATTGA
            ACCCGAATTGAAATTGAAATTGAAAACCAAAAGCAAAAACCAAATCAACTGGAACTAGCAAAACTAGCACCCACCGACCG
            ACATCTCCGACGATCTCCACCAGTACAACTCTTTGCCAAGTCAAGACATCCACGAAATCCATGTGATGAGGAGGAACCTC
            TTACCAGCACAGCCGCCGACAACCGACCTCGGTACGCCACCAGGAGCGCGGCGGAGGGGTGGGCGCAGGCGGCGGAGGTG
            GAGGCGTCGGCGGTGGCTACGAGCGGGACCGCGAACGGGAGCGGTACGAGCGGCGCGAGCGTGACCTCATGCACTACGAT
            CTCAATAGCGACGAGCTGCTGGACGAGCGCAACTTTGAGTATCCGGCGATGAGGAGCGGTCCCAGCGGCGCCTCCCACCA
            CGGCCATCTGTCCAGGGGCGGACGCCTGCTGGAGGATCCGGACTTTGAGCGCGAAGAGGCCCAGATGCGGATGAGCAGCT
            CACGCTACGGACCCTCGACCAGGATCGACGACCCACGGGATCTGCCGCGTGGCGCCACCGTTGTCGATCGCGATGAATAC
            AGTCCGCACAGAGGTGGTGGGAGTAGTAGGAGAATGCTTAATGCCATGTCCAGACCTTTAGGTCTGCCACGCCAATCCTC
            CCTGCCCAGTAATAGAGCACCCGTGTCGTATTTGCCACGCCAGTCCTCCCTGGGCACACACTGGCTATCCTCCTCCTCGC
            AGAGCAACCTGGATCAAGGACCCCAATCTCGCCGAGAGCTTTATCCACTGCTGCATCAGCCGCAGTCCTATTCCCAGCCT
            CGATCCCAGTACACCAGCCACTCGTATACATCCGCACCACAGCACACCAGTCAGTCGCGTTCCCAGTCCCAGTCGCACTC
            CCAGTCCCACTCTCAGTATCGCTACTCCGTGCAGGACACATCGTTTGCCCACCCACCAAGATCCCTGCGCGAAGAGTTCC
            TCAGTCCCACCATGAGCAAGGTCGAAGCTGTCACCCACGCCATTCGCAACAAGATCATCGTGGAGGAGGACGAAGAGGAT
            ATCCTGAGCACGGATCGGTTCTATTAAAGAGATTTCAGTCGTCCAACCCGCGTCGATTTTGGTTTGGGTAAACTCTTCCT
            TGCGGGCGGGAAAGCAAGTGCAGCAGTGCCAAAACACACGACACATTTGTAAATGTTCCATTCGATGATCAGATCAATTT
            GATAGATACAGCGACACAGATACATCCACACACACAAACAGAAACACACACACACAAAGTAGCTGGTTAAAGTTAAAGTG
            AGCGTTAAAGTGGCGGTTAAAGCAAACCAAAGGAAGCAGCCCAATGCCAAGTGGGGCCTTATGTGTCTTAAATGCTATAG
            CTAAGTGTAATCAGATTTTATTTGAGTAATGTGAATTTAAATTAAATGGTCTAAGCCTAAGATTTAAGCTAGTCGACAGT
            GGGAAATTAAAAGTTAAAAGAAAGGAGTCCGAAACCAAAGCCAACAGGATTTGTTGGTCCCCAAATGGGTCTCGTATTTG
            TTATGCAATCGATTGACTAAGTACATGAATAAGTGTCAGCTTTAATAATTTAGTGAACGTGTCTTAATCTAAGTCGAGCC
            ACACAAACACACCTCCACACACTCGACACACACACACACACTCTTACACTCTCAATTGACTGTGAACCGATTGAAATCTC
            TTTAATCTCAAACCGATACCTATTTCTCGCATCCAGCGCTTTTCCTTCTCTACACAGAAAAATTTACACTTACAGTGCGT
            CTCAAAGCCATATGATCATGAGTTGAAATTAATTGATATATCCATAATGTATTTATTCTATAATTTTGAAAGCTTAAGCT
            TGAAGTTTTTAACTGAATATTTCTTAAATACGGCCGTACATCTAATACTATCATTTTATTAGTTGTTAAACATTTGTATT
            ATATATCTTGAATGAAACGCATTGTACACAATTTCAACTTCCAACAGCAATACTTTCGACCTAGATACCTTGCCACACCA
            TATCATGCCACACACCTGCCAAAGCGCACAGTTCGCGATCTCAGTTCAAAACTCAAGTTGAACTAGCCGCGAACGGGCCT
            GCAACCTGGATAAGGATCGAAAATCGATTCAGGTTTAGGTATAGCGATTTAAACTACCAGTGCCTTATAAATCCATCAAA
            TCGAGTTACACGACAGCACTCCACCCCAGATATTCTGCATTTCCGCCGCCCCATTAGATCATTATTGACCACCACCAATC
            GCTAAAGTCGAATGCGTCAAAATTATTGTTCAAGTTTTGAATTGTACACGTAATGTTGAGACGATAGTCGTTGATCTGGC
            CCATTCCGAACGAGCACTCCTTTTACAATTCCAACCACCATGCTAAATTTGTCGATCATTAGTTGTCGAACTGAGCTAGC
            GCCCAACAATGATGAACCGCACTGCATTCAAATCGATCGCCACCACCTCGAGTAAGAGTCGATGTTCAGCTAGTTTTGAT
            CTGTAAGCACACCCACAGAACCCATCCTACTGTCCAAGGACAACAGCTGAATCCTGTAACACGGGGTCAGAGTTTAGTGA
            CAGGTCGGGCAATTTGCCCGCAGAAAAAATCTAGTACTTTTTTATATAAGAGATACAAGGTGATATAACTAATTTTCAGA
            AAGTAAATTTGAACAGCGCACGACAAATACAGATACCTAATTGAAATTGTTAGCCACATTCAGGAGAGGGAGGGTTTAAA
            AGGTCAGATGGGAGAACACCTCCCATCCCCTAGAGAATTTGAATGGGGTTGACCAAGGCACTGGAGGCGCTTTAACGAGG
            AACAAATTGAAATTTAAATATATAACGGAACGCAGCAAACGATACACAAGCACTTCTTGTAAAAAGTGGCAAAGCAAAAT
            GATCTATGTATTAGCTAAACCTAAATGAAATATTACTTTTTAATACTAGCATAAAGTTAAAAACAAAACTAGATACGATC
            CTTTGCAGCTAAGAAGGGGACAAGCGGAAAACTTAAGTTTAAATGGTCAGTTGATGAGAAGTGTGTATGTTAGAATATTG
            CACATAATTCACAGAACTGGTAATTCAATATATTATAATGGTATATATTAAAAAAGATACACACATTTATAGAGCTGCAT
            ATATAAATATGTATGTATGTTC
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0300536
            3739
            FBtr0300115
            4963
            FBtr0306386
            5788
            FBtr0310279
            4514
            FBtr0310280
            5025
            FBtr0310281
            4461
            FBtr0343616
            4530
            FBtr0343617
            5400
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0310210
            439
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0289763
            432
            FBpp0289392
            817
            FBpp0297478
            733
            FBpp0301962
            844
            FBpp0301963
            682
            FBpp0301964
            455
            FBpp0310211
            466
            FBpp0310212
            745
            Comments
            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (1)
            Reported As
            Symbol Synonym
            Ca-β-RO
            Secondary FlyBase IDs
              References (0)