Open Close
General Information
Symbol
Dmel\GABA-B-R3-RE
Species
D. melanogaster
Annotation Symbol
CG3022-RE
FlyBase ID
FBtr0343785
Feature type
Associated gene
Evidence Rank
Length (nt)
5991
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CATTGCAGCTCAATAGGGGAAATGAAAACAAAAGCAAACCCCAAGCAAAAGGCCAGCCAGAAAACGGAAGGGAAAATAAA
          CTCGGGCGCATTATGCAAGCCCAGTTGAGCTGGGAAACGCCAAAGAACTTCCCATCGACTCTTTCTCCCAGCTGGAAATG
          GAACGTTTAACAAATGCCAAGGCGGACACTTCTATTTCAGACGGCCTGACTGACTCAATGCAGCCATAATTAAGAGTGTC
          CTCGTCAGTCAGTTCGCCATTGTTCTGTATTATTCGTTCCTCGAGCAAAGGCAATGCGAATCGACAGCTGTCCTCTTTTC
          TCGAAATCTTCTGGCAGCGGGATAAATGAATTTTTCATTATAACAGTTGCAAATTATTTAGTTTCATGTTGGGCATTAAT
          TTACATAATATAAACTTTGCCAGCACAGTTTTCAATTGCCACAGCTTGTTGCTTGTTGACTGAAAGTTAGCGAATGGCGT
          GTAGTTTTTTCCCGTGTTACCCAATCCTGTCAATCGGACCTATCGAGAAAGTCCTTTGCATTGCATACTTTTATGGTCGA
          CTGCTGTGCAGAGTGAATGTGCAAAAAGATACAAAATGCGAGCAAAAGTGAGGCCAATAAAAAGGCGATAAAATTGACGC
          CGATACAAGAGGAGGGAGCAGAAGGAAGAGCCGCTCGTCGGAAGAGAAACGATAAGCGTATCCTGTCGGCAGAGTGCATA
          AAAAGGCGATATATATTCCGGTGTCCTGTGCTGTGTGGCTCGTGTTTGTTTGTTGCTGCAGCCTCTGATAGCCGACGATT
          CAAATGCCTTGGTGATTAATGGGCCATTGGCCATTGCCGACGGGATGCGCATAATTCAACCGGTCCAAGGGACCAGATAC
          GGTCCATGGCCGGCCGTGGGACTGAGGCTAGTCCTGGCCCTTGCCTGGGCAACGTCGGCAGCGGCTGCCATGGAGTCATC
          AGCCGAGCTGCAGGCCCTGGGCTACGAGGCAATTAGGCCAGGTGCTGCCTCAATTAGCACATCCAGCCCATCCAGCTCGC
          CACCCGGAGAATCGGCATCGACTGTGACTGCAGGGGGGACTCCGATTCCACCGCGCTCCGATTGGAAGTACAAACGGACG
          AAAGTCAAACGCCGGCAGCAGCGCCTCAATTCGCACAGCAATCTGCCCGGAAGCACCAATGCCTCCCACGCCCACCACCT
          CCTCAATCTGCCCCCCAGGCAGCGATACTTGAAGGTCAACCAGGTGTTCGAAAGCGAACGCCGCATGTCGCCGGCCGAAA
          TGCAGCGCAATCATGGCAAAATCGTGCTGCTCGGACTCTTTGAGCTGTCCACATCGCGGGGACCACGTCCGGATGGTCTG
          AGCGAATTGGGAGCTGCCACCATGGCCGTGGAGCACATCAACCGCAAGCGCCTGCTGCCGGGCTACACCCTCGAGCTCGT
          GACCAACGATACTCAGTGTGATCCTGGAGTGGGCGTGGATCGCTTCTTCCACGCCATCTACACACAGCCCTCGACGAGGA
          TGGTGATGCTGCTGGGATCGGCCTGCTCGGAGGTCACCGAGAGCCTGGCGAAGGTGGTGCCCTACTGGAACATCGTGCAG
          GTATCCTTCGGTTCCACATCGCCGGCGTTGAGCGACAGGCGGGAGTTCCCCTACTTCTACAGGACGGTGGCCCCGGACTC
          CTCACACAATCCGGCGCGCATCGCTTTCATTCGGAAGTTTGGCTGGGGCACGGTGACCACTTTCTCGCAGAACGAGGAGG
          TTCACTCGCTGGCGGTGAACAACCTGGTCACCGAACTGGAGGCGGCCAACATATCCTGTGCCGCCACCATCACCTTTGCG
          GCCACCGACTTCAAGGAGCAGCTGCTGCTACTTAGGGAGACGGACACGCGCATCATCATCGGCAGCTTCTCGCAGGAGCT
          GGCCCCCCAGATCCTGTGCGAGGCCTACAGGCTTCGAATGTTCGGGGCGGACTACGCCTGGATCCTCCACGAGAGCATGG
          GGGCTCCGTGGTGGCCGGACCAGCGCACCGCCTGCTCTAACCACGAACTGCAGCTGGCCGTCGAGAACCTCATCGTGGTC
          TCAACGCACAACAGCATCGTTGGAAATAACGTCAGCTATAGTGGACTGAACAATCACATGTTCAACTCCCAGCTGCGCAA
          GCAATCCGCCCAGTTCCACGGCCAGGATGGATTTGGCTCCGGTTATGGTTCCAGGATCAGTATCGCTGCAACGCAATCTG
          ACTCTCGTCGGCGGAGGAGAAGGGGCGTGGGAGGCACCAGCGGAGGGCACCTCTTTCCGGAGGCGATCTCGCAGTACGCG
          CCGCAAACCTACGACGCCGTGTGGGCCATCGCCCTGGCCTTGAGAGCCGCTGAGGAGCACTGGCGGCGGAACGAGGAGCA
          GTCGAAGCTGGACGGATTCGATTACACCCGCAGCGACATGGCCTGGGAGTTCCTGCAGCAAATGGGCAAGCTCCACTTCC
          TGGGAGTGTCGGGCCCCGTTTCCTTCAGCGGCCCAGATCGCGTTGGCACCACTGCCTTCTATCAAATCCAGCGCGGTTTG
          CTGGAACCGGTGGCCCTCTACTATCCGGCCACGGATGCCCTGGACTTCCGGTGTCCCCGCTGCCGGCCGGTGAAGTGGCA
          CAGCGGGCAGGTACCCATCGCCAAGCGGGTGTTCAAGCTGCGGGTGGCGACCATCGCTCCACTGGCCTTCTACACCATCG
          CCACCCTCTCCAGCGTGGGAATCGCTCTGGCCATCGCCTTCCTGGCGTTCAATCTGCACTTTCGGAAGCTGAAGGCAATT
          AAACTTTCCAGCCCGAAGCTGAGCAACATCACCGCAGTGGGCTGCATCTTTGTGTACGCCACCGTCATCCTTTTGGGCTT
          GGACCACTCGACGCTGCCCTCGGCGGAGGACTCTTTCGCAACGGTCTGCACGGCCCGCGTCTATCTGCTCTCCGCCGGAT
          TCTCGTTGGCCTTTGGATCGATGTTTGCCAAGACCTACAGAGTGCATCGGATATTCACTCGTACCGGCAGCGTTTTCAAG
          GACAAGATGCTGCAGGACATTCAACTGATCTTGCTCGTCGGCGGATTGCTTCTGGTGGATGCGCTGCTCGTAACCCTTTG
          GGTGGTCACCGATCCAATGGAGCGCCATCTTCACAACCTGACGCTCGAGATCAGTGCGACTGATAGAAGTGTCGTTTACC
          AGCCTCAGGTTGAAGTTTGCCGTTCGCAGCACACGCAAACGTGGTTGAGTGTCCTGTACGCCTACAAAGGCCTTCTTCTT
          GTGGTGGGTGTCTATATGGCCTGGGAGACGCGCCACGTAAAAATACCTGCTCTCAATGACTCGCAGTACATCGGAGTGTC
          TGTATACAGTGTGGTCATCACCAGCGCCATCGTCGTGGTGCTGGCCAACTTGATTTCGGAGCGAGTCACCCTGGCCTTCA
          TCACAATCACAGCTCTGATTTTAACCAGCACCACTGCAACCCTTTGTCTGCTTTTCATCCCAAAACTCCATGATATTTGG
          GCAAGAAACGATATTATCGATCCGGTTATCCACAGTATGGGCCTTAAGATGGAGTGCAACACACGCCGATTCGTGGTCGA
          TGATCGCCGAGAACTGCAGTATCGAGTGGAGGTGCAAAACAGGGTCTATAAGAAGGAAATCCAGGCTCTGGACGCCGAGA
          TTCGAAAGCTGGAGAGGCTACTCGAGTCGGGACTAACCACCACCTCCACCACAACTTCGTCGTCCACATCACTCTTAACT
          GGGGGAGGTCATCTAAAGCCAGAACTGACGGTAACCAGTGGCATCTCGCAGACTCCGGCTGCAAGTAAAAACAGAACTCC
          AAGTATCTCGGGAATACTGCCCAATCTCCTGCTTTCCGTGCTGCCTCCTGTGATTCCACGGGCCAGTTGGCCGTCAGCAG
          AGTACATGCAGATCCCGATGAGGCGTTCTGTTACCTTTGCCTCCCAGCCCCAATTAGAGGAGGCCTGCCTGCCTGCACAG
          GACTTGATTAACCTCCGTTTAGCCCACCAGCAGGCCACGGAGGCTAAGACGGGCTTGATAAACCGATTACGAGGGATATT
          TTCTCGCACCACTTCGAGCAACAAGGGATCCACCGCCAGCTTGGCGGACCAAAAGGGTCTGAAGGCGGCCTTTAAATCGC
          ACATGGGACTGTTCACCCGCCTGATTCCCTCCTCTCAAACGGCGTCCTGCAATGCCATATACAATAATCCAAATCAGGAT
          TCCATTCCCTCAGAGGCGTCCTCCCACCCGAATGGTAACCACCTAAAGCCCATCCATAGGGGTTCATTGACCAAAAGCGG
          TACTCACCTGGATCACCTTACCAAGGATCCGAATTTCCTGCCTATCCCCACTATTTCTGGCGGTGAACAGGGGGACCAAA
          CGTTGGGTGGAAAGTATGTGAAACTGCTGGAGACCAAGGTGAACTTCCAATTGCCCAGCAACCGGAGACCTTCGGTGGTG
          CAGCAGCCACCCAGTTTAAGGGAAAGGGTAAGGGGTTCGCCACGCTTTCCACACCGCATCCTGCCGCCCACTTGCAGTCT
          CAGCGCCCTGGCCGAATCCGAGGACCGTCCCGGAGATAGCACCTCTATCTTGGGCAGCTGCAAGTCCATACCTCGCATTT
          CGCTGCAGCAGGCCACCAGTGGAGGCACCTGGAAATCGATGGAAACAGCGGGCAAGTCGAGGCTTTCCCTCGGCGATTCC
          CAGGAAGAGGAGCAGCAGGCGCCTGCGAATGGCACCGAATAAATAAGATGCCCTGTCCATTGTCCACTCTGTACACGGTC
          CACACTTCAAATCCAAGTCCAAGTCCTCGTCAATTAGAAGCGAAACACCAAGCAATTATTTTACGACACGCCCACAAAAT
          CTGCCCCAGAATAGCGCGTGTGCAACTGACCAATCATCAGCTTAAAGCAATCAAATGCATTAGGGTAAAACGCTAGATAA
          GTCACGATACGAACCTCCCCCTCCCTCCTCAAGTCAAGTTCACATAGCTAGTCATTTTCCTGAACTTAGCAGAATCAACA
          ACACGGAGAAAATTGCAGGCACATTGTGCTCTGCCTAGAAGTAGACAAAATTTACAATGTAAACTAAGAAATTTGTGCAA
          TGTTAGAATTTATCTTAATTCGCGAGTTTTCGGTATCAGCAAAGTTTTCTAAAAACTACCAGTATCAGTATTCGCCTCGG
          GGTGCCAAATGTTTACTTCTTGATAATCATTTCTTAAGACCTAGTGTAGTGTTCCTTTACTAAGCATGCATATTATTTCC
          TTAAGTATTTCGGTGAAAAAAGATGATAGCTCTTTAAATGGGTCTATAAAAATGTTGATTCCATTTTTTTCGTTTTAATT
          GATAAGATAACATCGCGGTCGTTTAAGCTTAGTTTTTGACCAAATCGCATCTCTCTGTGTAGAACCTACTCCGCAATGTG
          ATTGACCCTGGGCCGCGTAGGACCATCATCTAGGTTAAGTAGATGCGCTTGTCGGCCACTTTCAGTTTCCCAGCCAGTTG
          TGATTAACCCGCTCCTTAACCCCTTGCCACTAATCATCCTCCTAGTCGTAAGTAGCTGCATTAGCGTTTGTTTTCTTGTT
          GTTGTGCCGCCGCAGGACGGCTGTATCTGCGGTGTATCTACAGTGTATCCAGTGAGCAATACTAAGAATCGTACTTAAAG
          TTAGAACCTAGCATCAGCCAAGATCCAAAACCAGAACCAAAGTAGTCAGAGTAGAGTAGGGGTTGGCAGCCAGTGAGTAT
          GATTAATCATCGCCGACTAGCCTTGAATCATGTAAGAGTCCAGAGATGTTTGGGGCGAGAGCCAGAACACTTGAGAACTG
          CTCAAGACTAAGTCGTAAGTTTTAGCATTGTAATCCCAATCGACTTCGAGCCACACTCCAACAATCCAAAGTCCACCTTC
          CCACCCACTCGGATAACTTGAATAAACAGAAAAGTCTAAGCAGAAATGCCAAGCCAGAATAATGATTAATT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078001
          5466
          FBtr0301439
          2359
          FBtr0308257
          5730
          FBtr0343786
          5633
          FBtr0343787
          5987
          FBtr0346526
          5800
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0310350
          1305
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0077666
          1305
          FBpp0290654
          650
          FBpp0300577
          1305
          FBpp0310351
          357
          FBpp0310352
          1305
          FBpp0312144
          450
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          5' UTR based on RNA-Seq data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          GABA-B-R3-RE
          Secondary FlyBase IDs
            References (0)