Open Close
General Information
Symbol
Dmel\CG6299-RC
Species
D. melanogaster
Annotation Symbol
CG6299-RC
FlyBase ID
FBtr0343983
Feature type
Associated gene
Evidence Rank
Length (nt)
987
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 7 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GATAATTTGAGACATAAAATCGCGTTTTATCCCATGGTGCAAACCTGAAATCAGGTTTTCGTACTAAGCCAACTCGGATT
        GGATCGAAGTGTGCGGAACTCGAGCTCTCTGGCGGCTCTCCAAGATCCAAGACGCCAGCTGTGAGATTTACCAATCAGTC
        GGCGTTCGAAGCGCATTGGATACGGAACCAATCGGAGAGCTAAGGAGAGCAGAAACGCAGCAGAGCAGAGCAGGAAATTA
        GAGGACGGAACAGGACAGAACAGGAGCACACGATGGCAGCCAGCGAGGGATCGGCGGCGCGCATTCAGTTCAAGGCGCTG
        CGCGGATTTCCGGCCATCGGCGATACCGCTGATAAGCTGGAGACACAGGCCTTTCTCGACGCCTCCAAGGAGATAGTAAC
        CGTCATAGAGAGCTTCGGCAAACTATTCACACCCGTGATCAGCGACATGAACGGAAACATAAACAAACTGACGAAAGCCT
        ACGGAGCGGATGTGGTCAAGTACCAGTATCTGGAGGATCTGATCGTGCTGAACGTGAACGTGGACGACTTTGCGGCCAAC
        GCGCTGCTCTGGCTGAAGCGCGGCCTGCAGCTCATATGCACCTTCTTCGAGAACATCTACAACGATGCCCAGGCCAAGGA
        GGCACTTAAGCAGCATCTGCAGGACGCGTACGAACGCACATTGAAGCCCTACCACGGCTTCATCGTCCAGAGCACAATCA
        AGATCATCTACAGTTGGGTGCCCACGCGCAGCCAACTGCTGGGCCAGGGTGTCGCCCAGGCGGAGAACATCGAGGTGCTG
        ACCAGCTTCCTGCCGCGTATGCGCGCCCATCTGGACTCGATCGACGCCCTGCTGAAGGCGCACAACTTGGACGATGCACG
        AAAGGTGTGATCGTTCCTTAGCCTAGCCTAGCCTAGCTTAGCTTAAATAGCTTATCCTACTTTATTATTTATGCCCATGT
        CCAAGTAAAACGCAGAGCCTTACTTAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0074033
        1013
        FBtr0074032
        2551
        FBtr0343984
        1003
        FBtr0345130
        838
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0310435
        205
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073850
        205
        FBpp0073849
        205
        FBpp0310436
        205
        FBpp0311351
        205
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Monocistronic transcript; alternative dicistronic transcript(s) exist.

        5' UTR based on RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG6299-RC
        Secondary FlyBase IDs
          References (0)