Open Close
General Information
Symbol
Dmel\CG6299-RD
Species
D. melanogaster
Annotation Symbol
CG6299-RD
FlyBase ID
FBtr0343984
Feature type
Associated gene
Evidence Rank
Length (nt)
1003
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GAGTAGTAGAAATAATTTAAGAAAGATATCATTCTGTTTGAATGCAACTCAATTAGCCAGCAATCAATTAAGCTGATAAA
          GATTCCGTCGAAAGATTCCCCCGCCACGCAATCAAATTGCTTGATAAAACCGAAACCCAGAGCCCAGCCATCATCGATTT
          ACCAATCAGTCGGCGTTCGAAGCGCATTGGATACGGAACCAATCGGAGAGCTAAGGAGAGCAGAAACGCAGCAGAGCAGA
          GCAGGAAATTAGAGGACGGAACAGGACAGAACAGGAGCACACGATGGCAGCCAGCGAGGGATCGGCGGCGCGCATTCAGT
          TCAAGGCGCTGCGCGGATTTCCGGCCATCGGCGATACCGCTGATAAGCTGGAGACACAGGCCTTTCTCGACGCCTCCAAG
          GAGATAGTAACCGTCATAGAGAGCTTCGGCAAACTATTCACACCCGTGATCAGCGACATGAACGGAAACATAAACAAACT
          GACGAAAGCCTACGGAGCGGATGTGGTCAAGTACCAGTATCTGGAGGATCTGATCGTGCTGAACGTGAACGTGGACGACT
          TTGCGGCCAACGCGCTGCTCTGGCTGAAGCGCGGCCTGCAGCTCATATGCACCTTCTTCGAGAACATCTACAACGATGCC
          CAGGCCAAGGAGGCACTTAAGCAGCATCTGCAGGACGCGTACGAACGCACATTGAAGCCCTACCACGGCTTCATCGTCCA
          GAGCACAATCAAGATCATCTACAGTTGGGTGCCCACGCGCAGCCAACTGCTGGGCCAGGGTGTCGCCCAGGCGGAGAACA
          TCGAGGTGCTGACCAGCTTCCTGCCGCGTATGCGCGCCCATCTGGACTCGATCGACGCCCTGCTGAAGGCGCACAACTTG
          GACGATGCACGAAAGGTGTGATCGTTCCTTAGCCTAGCCTAGCCTAGCTTAGCTTAAATAGCTTATCCTACTTTATTATT
          TATGCCCATGTCCAAGTAAAACGCAGAGCCTTACTTATAAACC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0074033
          1013
          FBtr0074032
          2551
          FBtr0343983
          987
          FBtr0345130
          838
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0310436
          205
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0073850
          205
          FBpp0073849
          205
          FBpp0310435
          205
          FBpp0311351
          205
          Comments

          Monocistronic transcript; alternative dicistronic transcript(s) exist.

          Transcript terminates at site supported by polyadenylated cDNA.

          5' UTR based on RNA-Seq data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG6299-RD
          Secondary FlyBase IDs
            References (0)