Open Close
General Information
Symbol
Dmel\Fer2-RC
Species
D. melanogaster
Annotation Symbol
CG5952-RC
FlyBase ID
FBtr0344010
Feature type
Associated gene
Evidence Rank
Length (nt)
1351
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTGCGTAAAAGTGTCGGAAAAGTTAATAGTCGTTCTAGATTTTAATTGGATTAATATTGTTTAGTGAAAAAATAACACA
        TTTGATAAGAAAATGTCGCGAAATCAATTGCCGGATTCGTCGTCTTCACCGCCCATTAGCCATTTACCCTTCCACAATTT
        CGACGATGATCTGATTAACGATTTGCCCTCCTGCATTTATGCGGGTCAGCATCAAGGCGGAGGCGCCACCGGTGGAGGTG
        GTGGATCGGGAGGTGGCGGTGGCAGTTCTGGGCTGCGTCTGAGCTCCAACAACCTGCGTCACATCCAGCAGCATTATATG
        CAACATAGCGGAGAAAATCTGCTCGACTCCTCTACCAATCCAATGGGGGTGCACAATTCCGGGGGAGGAGCACCCTTAAT
        GTGCAACAGCCCCAGTGCCAGCAGCAGTGGAGGAGGGTGCGGCAACGCAGGATCTGCTACTCCTGGCGGTGCAGGTGGTC
        CCAATCCTGGATATGGATCCGTGGGAGCTGCAACTGCGTCCAGCTACAAAATGCAGCGACAGGCGGCCAATGTGCGGGAA
        AGGAAACGCATCCAGAGGTCCGCCCCAACTGGTAGCATCAATTCGGCTTTCGATGAGCTAAGGGTCCATGTACCCACCTT
        TCCGTACGAGAAACGTCTGAGCAAGATCGACACTCTGCGGCTTGCCATCGCCTATATATCTCTGCTCCGTGAGGTACTAC
        AAACCGACTACGATCCCCTAACCTATGTGGAGAAGTGTCTGCGCGGAGAGATCAAAGCGGATAGGGCTAATTGGAATACG
        AGTGATCTCACAGCTCGTCTGTCGTGGATCAACTGGGAGAACCTCGGAGTACATCCTGGTAGGCGAACCCTGCTTACCTC
        GTTGGCTCTCTCCTCGGAACCCATGTGCGGAGCTCATTGCGGAATGCCGTAGATTCGCTCTATATATTTGAGGCTTAGCC
        TATCAACTGCTGAAAGCACTTACCACTTAAGCTTCTGATCTTCCCCAAAGATTACAAAGTCTTCCCTTTAGGTTTTGATA
        TCCCAAAATAGTTTAAGGCTGGACATATTTCTACAGTTACTAACAGTTAGCAATAGTATTTTATTTGAAAAGCGTCTCGG
        CTGCACGAAATACAAGACCCATCTGCCATTGAAGCCCACTACTGTGTTTAATAAATAGTTATTGGTTTCAAAGGCTCGCA
        GGATAATGCATTTACAAATCAATTCCTCAAATTATATTTCAGGATAAATCTTTTGTAAATAGTATTGAGTATTGGGCAAC
        CGATCTGACAAACCGACAAACCAGTTGCAGCTAACAGACGTTTTACAGTTAGTCAACTATGTAACAACTTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0301709
        1336
        FBtr0344011
        1363
        FBtr0344012
        1333
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0310461
        279
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0290923
        274
        FBpp0310462
        283
        FBpp0310463
        273
        Comments

        UTR(s) based on RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Fer2-RC
        Secondary FlyBase IDs
          References (0)