Open Close
General Information
Symbol
Dmel\CG40498-RJ
Species
D. melanogaster
Annotation Symbol
CG40498-RJ
FlyBase ID
FBtr0344186
Feature type
Associated gene
Evidence Rank
Length (nt)
1681
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AATGTATTTTCGTGTTAAATACTGAGAGGAAGGAACTTTAAGGACAATCTTATAATGAGTTTTCAGAAAAGATTTTGCAA
          ATCATAATAATATATTTGAAGAATTTGCTGAAGTTGACGAGTAAAGCTTGAGCACAACGTCGCAGCTAAAATCCTGAAAA
          TACATCACACAATCTGAAAAATCAAGCGGAATATCGATTAAGGTAGCATATGAATCGGGACAGGTCGGATGGAACTACAA
          TATCACATGGCTGCCCTAGGCATATTTTTTAGCAAAAGACCAGCTAATTATATCTGTATATACGTAGTTAAGGAAATTGC
          ATAGCTGAAGTGCCGTACAGCATAATTCTGATATTGAAGTAGTTAGCTTACTAACTAAATAAATTGACGATATGGAACGG
          CGGGCATTACCAATGTTATAGACGCGTGGAAGCCAACAACGATTGAACTAAAATGCATTCAGTGGGCATTCATTCCGCAA
          TGGCGATCAAAAGGCAACGGAAACGTCGAGATGAACAAAAAAGGGCGCGAGAAAGACGCTATAGCACGCAAAGTTCTGAG
          AGCGGCGAAACATTTCATTCTCCAACAGGATCCGTGAGGCGAAAATACCACCATCCTCGTAATGCAGTTAGTTCTGGCAC
          CGGAATGCTTGACAGCCAGGTAGTTACTAGTATTGGCATGTTGCATATAGGTATTGTATTCGTTGTGTTTGGAGTTTTTC
          TTTGCGGTGCTGGTATTATTCCAGACGAAACTATGTCATGGAACGTATTTAGCTCAAGCTCAGCCTGGTGGAATGAAGTT
          ACTTGCACAGGTTTATTTTCTCTGGGATTGGGACTGTTTTTACTAATTTTAAACTGTCTTATAAGCCGAAAAGAGGAGGA
          GGATCTTGAAGACTATGTGCAACGTCAACTAACTCGATCTCGCTCTGGACACCGACTTGAAAGAGATGTTGAAACTGGTG
          TTTTGACAACGCGCCATGCTCGCAAAGCTGTTGCCTTACAAAAGGGCGGACGTAATAACTCTCCTACAGATGTTTCCGTT
          GTAAATTGCGGCTCTTCAGAGAATATGAGCAATGGAACGATAGTCAGCCATAATGTTTTAAACAGTTCTGATGCTATCCT
          TGAAAAAATTGTGGAGGAGGATAATACTTATTTAAACGACCGCAGCTCCGGAATATCTCCAATTGATTTAGAAAATGATA
          AGAAACTGCTTTTAAGAAGAGAATCTCTAAATGACGCAATCAGTATAACACGTATTTAAGAAACTTAATTTTTTACTCCT
          TACAAATAGTACATGGACAAAAGAAATAAATTTTTTAATATCCAAAGGCTTTATAATACAATAATCATATATCCTCTTTG
          TCACTTACGATTGAATACATATAAAAACACTGCATAATCATTATAACATAAAACCCAAATGCATGTTTTAGTAAAAAACA
          AGAGAGAATAGTAGAGTTCTCCGATTATCAGATACCCGTTTCTCAGCTAGTGAAAATGAGAAAGCGAAATTTCATAAATT
          TTCTGGGATTTCGATAGATATTGGGGAATAAAATTAGAAAATATTTAAAAATTGTTCCAAAGTGTGGGCGTGACCAGCTT
          GACCGCTTTAGGGCGTGGGTGGGCAAAAAGTTTTTTTCAAATCGATAGAAATTTACAAGACTAATAAAAATGTTAAAGAA
          T
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0302340
          1605
          FBtr0308892
          3210
          FBtr0308894
          1443
          FBtr0344187
          1439
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0310598
          268
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0291544
          268
          FBpp0301019
          268
          FBpp0301021
          268
          FBpp0310599
          268
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG40498-RJ
          Secondary FlyBase IDs
            References (0)