Open Close
General Information
Symbol
Dmel\DPCoAC-RF
Species
D. melanogaster
Annotation Symbol
CG4241-RF
FlyBase ID
FBtr0344282
Feature type
Associated gene
Evidence Rank
Length (nt)
2089
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AATTGCTCTTTGGAGCTTCGCAGGCGGAGTCCGAGAATCGCGCGGAAAATGTGCATTAACAAATAGAAAAATCCGAAATA
          AAGACAAAGAATTAGCTCGCGGTTAAAGAGAATACAGCACCTGTGTTTTTGGAATCGAAAATCAGTGCGAAACGCCTACC
          ACTGCTGTGTGTTGTTGTTATTGTTGCCAAGGCCGAAGGAGCGAAAAGGGAGGCCGAAAAAAAAGAATCTGTGCTAACAA
          AAACAAAGCGCCGGCAACAACAGCATCCCAGTGCACAGTGGTCGAAAAGTGTCGTTCATCGCTCGAATTCCTTATCAAAA
          AATTTGTTTATGGAGGGGGCACATATCAAGAGGCTGTGCTAAAATCACACTTAAGCCGCAAGCAAAGGCGCGGAATATTT
          GCTAAACTACTTTTGGCCCAACTTTTCAAGATAGAAGAGCTGAAATCGCTAGGTCCCCCAGTCCGAGTCTGCGATGAGCC
          GACTCCTGGAGAAGCCCAACATCGCCATGTCCATCAAGTCCACGGGTAGTCAGCTCTCGAGCACGATGACGACAGCCTCG
          GCGACGCTGTCCTCGGACCTGGACGATGCGGACACATCCCGCACCCAGCTGAGTCCATCGGAAACATCTGGAGTAGTCCT
          CGTACCCGCCACTACAGTCACACCCATGCGCCAGAAAATCGACCAGGTGGTGATCAGCCTGATATCCGGAGCAGCGGCGG
          GGGCGCTGGCCAAGACGGTCATCGCCCCGCTGGACCGCACAAAGATCAACTTCCAGATCCGCAACGATGTGCCCTTCTCG
          TTTCGAGCCTCGCTGCGCTACCTGCAAAACACCTATGCCAACGAGGGCGTTTTGGCCCTGTGGCGGGGGAACTCGGCCAC
          GATGGCCAGAATCGTGCCCTACGCAGCCATACAGTTCACGGCCCACGAGCAGTGGCGTCGCATCCTGCACGTCGACAAGG
          ACGGCACCAACACGAAAGGTCGTCGGTTTTTGGCTGGCTCCCTGGCGGGAATCACCTCACAGTCGCTGACGTATCCTCTG
          GACCTGGCACGCGCCCGCATGGCCGTCACGGATCGGTATACTGGCTATCGGACGCTGCGACAAGTCTTCACCAAGATCTG
          GGTGGAGGAGGGTCCGCGGACGCTGTTCCGCGGCTACTGGGCGACCGTTCTCGGCGTGATTCCCTATGCGGGCACCTCCT
          TCTTCACCTACGAGACTCTTAAGCGGGAATACTATGAAGTGGTCGGCAACAATAAACCCAATACTCTAGTCTCGCTGGCC
          TTCGGTGCTGCGGCTGGTGCCGCCGGGCAAACGGCCAGCTATCCATTGGACATTGTGCGGCGAAGAATGCAGACAATGCG
          GGTGAACACGGCTGGCGGAGATCGGTACCCAACCATCCTGGAGACTCTCGTCAAGATCTATCGTGAGGAGGGCGTCAAGA
          ACGGTTTCTACAAGGGACTTAGCATGAACTGGATCAAGGGACCCATCGCCGTGGGCATCAGCTTCTCCACCTACGATCTG
          ATCAAGGCGTGGCTCACGGAGCTGGCCAACTTGAGACGGGTTGAGAAATAGCCCAGCTCCCTGCCCCTGCCACTCGTCAC
          CCATAAACACCACACCAAAAACGCACTGCTTTGATCTTAAGTCTCGCGATCGATGGATGAGCTGAGGAAATAGAAGTGAA
          GCACCGACATGCTCTAATTGTTAGATATTTTTTAGCTGTTAGTTGTGAGGGAGAGAAGCGATGAAGTGAAGACACCCGAA
          AGCGCTTAACTTTGTTATTAACCGTAATTGATTTATTATCGCCGTAAGCCGAAAGTATATCAGCCAATAAACTGTCTGAA
          TAATGACTCGCCTGGCACATACTGCTCCCCAGGACCTCGTATTCAATGGTGTTGCTTTGACAATAACACTCCTAGATTAA
          TGATTACGATTTACCCGAACATTTTGTATATTGTGTATTGCCAACTCAATGTCAAGGCGCTGCGACTGTTAAAATAGTCA
          TGAATTTGAGGGTGTTCACACCAGCATATACTATGTAATTCTTGTATGTTAGTGTGTTTTTATTATTAAAATTTACAAAA
          TTGTTTAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0089480
          1654
          FBtr0089481
          1336
          FBtr0089482
          1898
          FBtr0344280
          1901
          FBtr0344281
          1440
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0310687
          365
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0088485
          365
          FBpp0088486
          290
          FBpp0088980
          365
          FBpp0310685
          364
          FBpp0310686
          290
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          DPCoAC-RF
          att-ORFA-RF
          Secondary FlyBase IDs
            References (0)