Open Close
General Information
Symbol
Dmel\CG31191-RD
Species
D. melanogaster
Annotation Symbol
CG31191-RD
FlyBase ID
FBtr0344322
Feature type
Associated gene
Evidence Rank
Length (nt)
4416
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACAGTTCATCGACAGTCCTCGTCTGGTTGGGTCCTTGGGTGGCAAGCGCGGCAAAAACGCAAAAACGCAGCACGAGTAGC
        AGCAACAGCAGCAACAGCAGGCACAGCAACACCAAAAGCAGCAACAGCATCTGTATCAGCCATCAGCAGTTCGTCCTGAA
        AAGCAAAAGAGCAGTGCGAGTTTTAAAGTTTCGTGGCTTATTTCCCGGAAATACCCGGTGACCATTTCGCGAGTTTTATA
        TTCGATTCGATTCGAGTGCGGACTGAAGCGGTCAAAAACGGAGCTTCGGGTTCCTCATCAAAGAGCAGTCAGCCGGATTA
        ATCCAAGCATTTGGGTTTGCGCACCGCCCAGCGGCATAAAATGATAAGTATTTGGTACAACAGTGACCACCGCGATTGGG
        TACGCGTTGCCGGACGATAGTACCCATTGTACCCTGTCAAAGGGTTGAGACCATCATCACTGCGCAAATCATCCTCCGCC
        AGCAGCAGCAGCATCAACAACGCCTGTCCCCCACCGCCGCCCACGCCGCACCAAGTGAATCCCGCCAGCAGCAGCAGCAG
        CACTCCGCCCCATTCCAATTCTAATTCCCAGCATCCGTATCCGCATCCACATCACCATCCACTGCCGCACCACCCGCAGT
        ACCAGAACCACCAGCACAGGCGCAGCAGCAGCTCCAGTCACACCAGCCACGCGGAAAACTCAAGCGGCTTGGCCACGAAA
        CCGGCCATCAATTTGCTGGCCAATCATCTGCAGGCCAACTACTTTGAGTTCCCGCCCACCGCTCCTGTCCAGGCGTCGTT
        GCACCACAGCGGACGCACCGCAGTCTCCACGCCGTCCCTGAACTTGCAGCAGCACCACCACCACCAGCATCCGCACCAGC
        AGCAGCAGCAGCAGCAGCAGCAGCCCCCCTGCACCACAGTCAGTGGTCAGTACAGCTCGGCTGTTGCCAGAGCGGCTGCC
        TCCACGGCCTGCGCGCTCCTTGCCACGTGCCACGTGTCCAGGGATACCGATCAGCAGCCGCCCAATCACCAGACACACCA
        GCCTCAGAACCCGGAGTACCTGCAGCCGACCGCAAGCAAAATGGGGCGACGCGAGATAAAGCGCTCTAATACCAGTGGCT
        CCACCACTAGATCCTACGACAGCGGAAGCGCAACCACAAACTTCGTGGGCAAGTTCACGCAGAGTGTGCGCCGAATCGTG
        CAGGATGTGAAGGACGAGGGGGCGCCCAGTGGAATGACGCGGGACGAGGTGATCGAGACGAACGAGCGCCTGCGATCCTT
        GCGCCTTCGCCTGGAGGAGTCCTACGAGACCGCCAAGAAAGCCCTGATCAACCTCATGAACAAGTACGGCGACTCGAAGA
        GCCAGCGCAACATCTTTCAGCGCTATCCCATGCTCAAGCTGATGATTAAGGAAGTCATCCGCCTGGAGACCCAGTACTGG
        ACACTGGTGGACATCCCGCGGCAGGAGAAGCAGGAGACGGTGCCCTCTTACGTGATGCGGGCCTGCTCGATCATGGAGAA
        GACCCAGAAGTCCGGCGAGGGAGTCAAGACCTCCGCCCGCCTGGCAGAGGAGGCGGCAGAGCGGCGGGAGCGGATGGAGC
        GATTGGAACATATGACAACTGCGCAAATCGAACACGAGAATACGCAGCTAATAAACGACTTGTATCGCTTGCTGAAAAAG
        TATCTGGGACTGCGACACCTCATCCGTGTGTTGAAGGAAGAGTACGGCAGCTCAAAGATGTATCCGATATTTCCACGCTA
        CACAATGCTGAAGGACATGATAAAGGGCATCATGCACGATCCGGACTACATGGAGGTGTGCCATGAGACACTGGCCAACG
        CCAACTGAGCCGAGGGCACTGGAAATGGCAGGCGTCGCATGAGTGTCATTTGAGAGGGCCCAAAAACTAATAGCAATACC
        AATACAAGCAGCAGCATACACGGTCGCAGGACCCAGGATTAGAGTCCTGCGAAATGTGTATGCATATGTGCTGTTTTCGC
        ATGCGAATTTTCAAGAGATTCCGAAATGATTTAGAGCTTTCCGAATAGCTTCTTCAAAACTCCTCCGCCAGTGGAGCGGG
        TTCCTCAAACCTCTTTCGGCCCTTCTTTTAGCCAACACTCAAAGGCAAGCCAAGACAAACTAATCAACTAACTAACCAAC
        TACTAACTGAGCCCAGACCCCACCACCCACCACCAACTAAACAAGGAACTATTTACACTACATTATCAGATACAAACACT
        TCGGCACTGAAGTGCCAGCAAACAAACTAAAAGGCATTTATTTTAATGAACTTTTGAGATGAATACAGTGTTATACCTAC
        AAAAATACAAAATGCAAAACACAAGATATTTACTGATAAAATAGTGAACGATGCGCTCAAAGATGATGAACGGAAATCAA
        ATTGAGAATCAAACCAAACTCTGTGTAATTTGTATGTACCACTTACAACAACAAACTGAGCCTAGTATTATACACATAAA
        TATAGAGCAAGGAACATGAAATATACATACATACATATATATGTGAAGTAACCAAAGATACTCCAAAGCAGATGACTAAT
        GACAAATTGATAACCGTTTGATTTGGCTTGACCTTGCCACCTCTTTGAGTTTGTTTTAGATAAAGTAATGGTCGATAGCT
        GTTAGCTGATTATATCATACTTATTACCAAAGTGTATCAAATTGTATTGAATAAACCCCACGCCTAGATGTATTTATTAC
        TTACCTAGTTAGACAATATAAGGGAAATATTCCCAACCGGTGCGAGCAAATACTCCTAACACCTTTTAAGGAAACACCAA
        GCCCCATATCCTAGAAACTAACTGATTGTTGATTTTCTCTTCGCCAGTAACTATTAGTGAATAACAAATGCTTTATGTGT
        GTATCGAAACGTTCAGCTTTAAGTTCCCTGCAACGCGCAGACAAACCGAAATGCAAGTGTGTATTTCAAAAGTTCGTTTG
        AGATGCGTGCATCCCATGGATTCGTTGTTGTACAATGTACTTGCATACACATGCATACCTTGTAGCTTTGTAATCCCTCT
        GCCCAAACACACACTGCAAAAACTCGAGCACAAGAGACCAAAGTAAAACCTAGACGAGCTTACAACTTTTTACGAGAGCT
        AGACTCCCGCAAATGCCCTTTCCCTTTTTTTTTTTTTGTTATTTTTGCATAGAAATCCCACTCAATTTAGTGCTTTAAAT
        TTGCGCCACTAATAGCCGGCGATTGAAACTGGCAGAAGTGAGATCCCCTCTTTACCACTGACACACCCACCGATACACAG
        TGCATATACATACCATAAATATATCTGACATATCTGAATATAAGCAAATCAGGAACAGATTCGAAAAGCCGCAGCTATCA
        TGAAAGTGCAATTGAGTGCATAAATTACTCGAACAATTGTTTGCTGCCCATTATATGCTTCACAGCATCTGACTGCTGGT
        TAATTTACCCCCACCATTACCGCCCGATCACCCCTAATGCATCCAATCGCTTTAATATATATATATATATACATATATGC
        ATATAATTTAACTGCCTCTGCCTCTCCGAGCGTTTAGTATGAAAAAATATTTGACAACGCTAGCCTTTCCATAGCCACAA
        TGAACAGCTGCATGGGCAGAAAACATTTATTTATAATAAATAAATAAAATAGATAATTGAATGTTGGAAAAATAGCGAAT
        CAACTATGCAAATTCATACTATAGAGTGATTTAACAAATTTCATTTAGATGATTAAGCCTAAGCGATGAGTTATGTTGTT
        TACGTAGTTAAATGTTGAGCATTAAATTTGAATTTGAAAATTTGAAAAATGTTTGCCGCCATTTGCATAAGATGCGGGGA
        TTAAATGAAATTAAAACACGCGATATACCCATAATATGAGAACAAATAATATACAAGTATGCAATTATAGCGAAACTAAT
        TAAAACTAAAACTGTAATGATCAGGTATTAAAGTTATGAAGTTTAATCAAAATATATTAACAAATGTGTGCATGCGAGTG
        TGTGCGTGAATGTGGCCAATACAAACAAACTCATTGCAATATAGAGAATACGGAATAAAACAATTGGGCAAATATTGCTG
        CATACCTAAGAAGGCAAACTTAAATACTATAGTTATATACGGCAATGGTATTCGTATTATTATACAACTTATACACGATA
        AACAACATATACCCGTGTACCCCACTTATACATACATACAGACCCTCATGAGGAACATGGCCGGTCGGTAGGTAGTCCTA
        CAAGCCCAAACTTCGTACAATTTTACCTTTTCAACGTCTCAGTGTCTAACAAAAAGCATTAAATGTATTTCCGCAAGGAA
        GTTACCAATATATTGCATGTATCAGTAAAAAAAAAATATGTGTGTCAAGACACTCGATAATATGAGAAAATCGATAAATA
        TATTGATATGCAAACG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0083984
        4416
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0310710
        495
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0083388
        255
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Stop-codon suppression (UAG) postulated; reflected in aa sequence of predicted polypeptide.

        Although this transcript is annotated as having stop coding readthrough, there may instead be a non-AUG translation start site that accounts for the longer version of the protein.

        translation_exception: stop_codon_readthrough

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG31191-RD
        Secondary FlyBase IDs
          References (0)