Open Close
General Information
Symbol
Dmel\SK-RR
Species
D. melanogaster
Annotation Symbol
CG10706-RR
FlyBase ID
FBtr0344555
Feature type
Associated gene
Evidence Rank
Length (nt)
3729
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 7 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TTTCAGTCTGTATTGTGTTTACACCCATGGCTGACGTAGCGAGCGCAGAGGAGCTAAACCTTCGAAGGCGACAAAATAAT
      AATAAAATCAAATAATAATAAAGAAATACCAATATATATATATCTTATATATATATTAAAGTAAATACGAATAATATGCA
      CAAGTACATGCATGACAGATGAAACGAAGAACAATAACTACAGCAACGGCCATAACAACAAAGGCATGAACAGCAGCAAC
      AATAATTTTAATAACGATAATAGCCACAATAGCAACTACAACAATTACGGTTACAACAGCAGCAGCTATCGTTACAGTTA
      CCTTACAATTACAATTACGTTCACGAGTCCCGTTTTTTTTCCAGTGCGTGCGTGTATGTGAAATTGTTAATATTAACAAC
      AACAAAAACAACATCGGCCGCGGCAAACAAACAAAATAGAGACGAAATAGCGTCAGTTTTCTTTTAACCGGATTCCGGTA
      CTCACACACACACACACTCACACATACACAGTTACACATACACACAATCACACTAGTACACACCCACACCCATACCAATA
      CCAGCAACGAGCAAACATTTAAAAATGAAAGACGAAACAATGCGATAACGGGATAACTAACAAACAAACCAAAGTTGAAG
      AAGAGGAAGACGAGCAACCGAACAAGAAGAAAACAACAAGCGAATTAAGCTCCGCAAACCGGCGTCGACACTCTCAATTC
      CTGGCTCGATGAAAACACCTTCCATTGCGAACCGGGAACAGATCTCATCTGGATGCAACGAAGAAGCGGCCGAGGCACTA
      GTGGGTATCCACTCAGACTACCCTAGGTATGAAATGTATATGGAAGAACGTGCTCTTACTGGCGGCAATACGTCCAGGAA
      GCCATCAACAAACTCGGCCAAACACAAACCCAATGTGGGCTATCGCCTGGGAAAGAGGAAAGCCCTCTTCGAGAAGCGCA
      AACGGATCAGCGATTACGCCCTGGTCATGGGCATGTTCGGGATCATCGTGATGGTTATCGAAAACGAACTGAGCAGTGCC
      GGTGTCTACACAAAGGCATCGTTCTACTCGACAGCGTTAAAAACCTTAATATCTGTTTCGACTGTGATTCTTTTAGGACT
      TATAGTAGCTTACCATGCTTTGGAAGTGCAGGTGAGATTATTCATGATAGATAACTGCGCTGACGATTGGAGGATCGCAA
      TGACATGGCAACGAATTAGTCAAATAGGGTTAGAACTTTTTATATGCGCTATACATCCAATTCCTGGCGAATACTATTTC
      CAGTGGACGACGAAATTGGCCAATAAGAATAAAACAATTGGCACCGAAATGGTGCCATATGACGTAGCTTTATCATTACC
      TATGTTCCTTCGATTATATTTAATCTGCCGCGTAATGCTGCTGCATTCAAAGCTATTCACAGATGCATCATCACGGAGCA
      TTGGCGCTCTCAATAGGATTAATTTTAACACAAGATTCGTTTTAAAAACTCTAATGACAATATGTCCGGGAACGGTTCTA
      TTGGTCTTCATGGTCTCGCTGTGGATCATCGCATCGTGGACGCTGCGTCAGTGCGAAAGATTTCATGATGAAGAACACGC
      GAATCTTTTGAATGCAATGTGGCTGATAGCGATAACATTTTTGAGTGTTGGTTTCGGTGATATTGTTCCGAATACGTACT
      GTGGACGTGGTATCGCTGTCAGTACAGGAATAATGGGCGCCGGCTGTACGGCTCTACTGGTGGCCGTAGTCTCTCGGAAA
      CTGGAGCTGACCCGTGCTGAGAAGCATGTGCACAACTTCATGATGGACACGCAGTTGACGAAACGGCTGAAAAATGCTGC
      GGCGAATGTTCTGCGTGAAACTTGGCTCATTTACAAACATACAAGACTAGTAAAACGGGTTAATCCCGGCCGTGTAAGAA
      CCCACCAAAGAAAGTTCCTTCTAGCTATATATGCGTTGCGAAAAGTTAAAATGGATCAGCGCAAACTAATGGATAATGCA
      AACACAATAACTGACATGGCTAAGACACAAAACACGGTCTACGAGATAATATCGGACATGTCTAGCCGTCAGGATGCCAT
      CGAAGAGCGTTTAACCAACCTAGAGGACAAAATGCAGAGCATACAAGAGCACATGGAAAGCCTTCCAGACCTATTGTCTC
      GATGTCTGACCCAGCACCAGGAGCGGATCGAGCAGCGGCGGAACTTTTTACATCCTGACACAGCTGCAGTTGCCCCCATT
      CAAGCGCCAACGCCCCAATCGATGTTCAATGCAGCGCCCATGCTGTTTCCACATTCTAGCTGAATATCAGAAAGAGAGCG
      CTCCAACTCCGTGATTAACATCGAGATGCTAACAATAAGGCCGGATCGATTCTGGCCAACCTCATTCGCACCCCAAAAAC
      CAACATCAACATTTACATCAACATCAATGTCTACGTCAAAGTGTAAACCCGAATTCGAAGTGGCCGAGACAGCGCTGAGG
      CAACGCGTGCTATCGCCGTCGTTATCGGAGTTTCAATCGAAATCGCAATCGAGACCATCGTCACAAACGCAAGAGCACAT
      TTTGCAAAGGGAGATCATACCGATGGTACCGATCATACCGATCATACCAGTGATACCGGAGGACGCCGAATCGTTGGGAA
      ACACCAATACGAACAGCAACAGTTCGCCCGATCAGCAGAATGTGCCCATGACTATAAGTACAGTACCGCCATCGAGTTCA
      GCGCCCGCATTCACAGCGACCGGAAGCGGAGGTTCGGTGACCGGAACTAGCGGTGGCATTGTGAAATCGATAACGATGAA
      CGAACCGATTACGACGGGGAGCGGCAAGCCGATTGCCTCGAATAAGTTTACTAGGAAAAGAGAACGTGTATGCAATAATA
      GTAGTTAATAGTAGTAGTCATAGTTATAGTAATAATAGAGGTAAAAGTAATATTAGTAATTCTACAAGTCGAATTTCGAA
      CTCGGCCTTTTGTAAATAAGCCTCTTCGAGATGAGAAAAAAGTCAAATGTTAGCATATACATATTAATATACAGAATACA
      CACACTATGTATCCTATATCTGTATACGGATATATATAGGCCTCCCCACAAAACATCCAAAAAGAAAGCAAAAAAACAAT
      AAGCGAAAACCGAACAGAATATATGTATACATATATATGTCATTGTGTAACTTTTTTTTTTTGTCTAAGTTTTAGGCTAA
      ACGTATTTGTAATATTTCACCTTGGGCCAAGGCAGCCTGTACATGCATACTAAAATACTTAACATAATATAGCATGTAGG
      GGGGAGTGTATGTGTGTGTATGTGCATGGGAGTGTGCGAATGCGAGTGTACAGGACCAGATTGGTAAGGAAGTTAGGTCA
      TATGTAGGACATAGATCGTAGGGCACCAGCATGTAGAATCCACGTATATAAACGCTCAGAAATAGCAACAGAAATAGCAA
      TAGCAAACCTTAAAGATCTGGCACCAAAAGTCCATAACAGTAAATTCGTATATCCCTTAAAGAACTGCAACCCCCAGCAC
      TTCCGCTTCCGGTGCAGCGCCAACCAACTGCAAAACATCCACGAACATGGCAAATTCTCGTGTCCGTCTGTCTCGAATTT
      GTGTGCATATATAAATTGTATCCGAAGGATGTGTGTCTGACCTGACTGTGTGTGCGAGGCAAGTGAAAGCATAAGCATAC
      GAGGAACCCATTAAAGCCCCCAACAATTATACACAAAACGACGCATAAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0300467
      3729
      FBtr0301949
      3723
      FBtr0301950
      3556
      FBtr0301951
      4813
      FBtr0301952
      3885
      FBtr0301953
      8828
      FBtr0301954
      3484
      FBtr0331602
      4946
      FBtr0331603
      8050
      FBtr0331604
      5179
      FBtr0344556
      8050
      FBtr0344557
      3885
      FBtr0344558
      4813
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0310908
      719
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0289694
      524
      FBpp0291161
      522
      FBpp0291162
      812
      FBpp0291163
      927
      FBpp0291164
      576
      FBpp0291165
      927
      FBpp0291166
      685
      FBpp0303992
      960
      FBpp0303993
      979
      FBpp0303994
      928
      FBpp0310909
      1174
      FBpp0310910
      771
      FBpp0310911
      1122
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      Stop-codon suppression (UGA) postulated; reflected in aa sequence of predicted polypeptide.
      translation_exception: stop_codon_readthrough
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      SK-RR
      Secondary FlyBase IDs
        References (0)