Open Close
General Information
Symbol
Dmel\Caper-RH
Species
D. melanogaster
Annotation Symbol
CG11266-RH
FlyBase ID
FBtr0344708
Feature type
Associated gene
Evidence Rank
Length (nt)
2623
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 40 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCGATAAGTTCTGTGACAACCCTGAAGCCGAAAACAAGCAGCCACGCTAGAGAAGAAAATCTGGTTGAAAATTGGCAAAA
        ATTCTAATTAAAAAATCGCAAAAGCCAAAAGAGAAGTTCGTAAGTCGTCCTACGAATTCCGCTGTGCGTCCCCACCACAT
        TTTGATTTCTCCAAACGTGCCAGACACCGAGCAGGGGACTTTTTTCACGGAGCACCCCGAATTGCAGCGAAGTAATTTTC
        GAATATGGCCGAGGACTTTGATGTGGAGGCGATGCTCGAGGCGCCGTACATGAAAAACAGAATCGAATAAGCTCAATATT
        GTTGCTAGAGATTGTTTTGGTCATTCTAAACACAAAAAGCTGGAGACCATTTGATATACTCCTCCTAACTTGTCTGGGGC
        AGCAGGCAGCACTACTACTACTCTCACTCACAGTCAGACAAGAATGAAAGTATCGCTCAAATTACAAATTACAGATTTAC
        GATAAACAGAAATCGAAATATAAGAATATATGACCAACACATAAGCCCAAAACGCAAAGCCAAAGCCTAAAACAAACCAA
        ACCTATTTGAACAAACAAAAAACACGACGTCTTTTTGAGAACCAATCAACCAGTCCACTCCACTAGCCAGCGCTAAACAT
        TCCCCCAAAACTGATCTGATTGAGAATGAGAATGAGCATGGGAAATTTGCCCATGTGGAGACAACATTTCTCGCCGTCGT
        GAACCATCTAATGTCAGTGCGGGCAGCGGTGGAAGTGGTGGACGCAAGCGCAGCGGCAGCAGTCCAGGCGGCGGCGGTGG
        ACACGATGACGACTACGCCGAGAATGGTCCGCGGAACGGCAGCGGCGGCGGAAGCTCACACAAAAAGCAAAGCAAACGAT
        CCCGGAGTAGAAGCGGCTCGCGTGATGGCAAATCTCGACGAGATCGCGGCAATGAACGCAGCAGTCATCGGGACAAGGAT
        AAGGAGCGCGATCGTAACCGCGACGGCGGCGACCGAGATCGACACCGCAGGGAAGGTGGCGATCGAGATCGGGAGCGGGA
        ACGTGAGCGCGAACGCGACAGATCTCGTCGGAGTCGTTCGCGTGATGAGCGCGGTGGAGGTGGTCGCTACGGCGATCGTG
        ACAAGGATCGCCGCTCGCGAGATCGACGCGGCGGCAGCAAGTCGTTGCAAGTGGATCGCTCGCGGGACAAGCGTCGACGC
        AGTCGTTCCCGCGATCAGCAGCGCAAACGGCTGAGTCCGATCCGTGAACGCAAGCGCAGCCATTCCCGCTCGAGGGACAG
        AAATAGCCGCCGTCGGGGAACCAATTCTCCGCGACGCCGCTCACCACCGAATGGAGCTGATCGCACCACGCCCACCGAAC
        TCAGTCCCGAGGAGCGGGACGCCCGCACCGTTTTCTGCATCCAGTTGTCGCAGCGAGTGCGAGCCCGTGACCTGGAGGAG
        TTTTTCTCCAGCGTCGGCAAGGTGCGCGACGTGCGTCTAATCACATGCAACAAGACGAAACGCTTCAAGGGCATTGCCTA
        CATTGAGTTCGATGATCCTGAGTCCGTGGCACTGGCCCTGGGCCTCTCTGGCCAGCGGCTGCTCGGTGTACCCATCATGG
        TGCAGCACACGCAGGCTGAGAAGAATCGTCTCCAGAATGCAGCGCCGGCATTCCAACCGAAGAGTCACACGGGTCCCATG
        CGCCTCTACGTGGGATCACTGCACTTCAACATTACCGAGGACATGCTGCGGGGCATATTCGAGCCCTTTGGCAAGATCGA
        TGCCATTCAACTGATCATGGATACGGAGACGGGCCGATCCAAGGGCTACGGCTTTATCACGTACCACAATGCTGACGATG
        CCAAAAAGGCTCTGGAACAGCTGAACGGCTTTGAACTGGCCGGTCGGCTCATGAAAGTGGGCAATGTGACGGAGCGACTG
        GACATGAATACCACCTCGCTGGACACCGACGAGATGGATCGCACGGGCATCGATCTGGGTGCCACGGGACGTCTGCAGCT
        GATGTTCAAGCTGGCGGAAGGAGCCGGTTTGGCAGTGCCCCAGGCGGCTGCCAATGCGCTGCTGGCTACAGCACCTCAAC
        CGGCGCCGTTGCAGCAGCAGGAGGTGGCACCATCGATAGCCACACAGTGCTTCATACTGTCCAATATGTTTGATCCGCGT
        ACCGAGACAAATCCTACCTGGGACGTTGAGATCCGCGACGATGTGCTGGAGGAGTGCGCCAAACACGGCGGGGTGCTGCA
        CATCCACGTGGACACCATTTCGCACACGGGAACCGTGTATGTCAAGTGCCCGAGCACAACGACCGCAGTGCTGGCAGTGA
        ATGCACTGCATGGACGCTGGTTTGCCGGTCGAGTGATCACGGCGGCCTACGTGCCCGTGATCAACTATCACACCATGTTT
        CCGGACTCCATCAACGCCGTCGATCTGGTGACGTCCACGCGCAAGAACACCGACGATTGAGCTGAATGCGTGGGCAAAAA
        TATTGTTAATATTCGTTACAAGAACTAATTTTTGGTCAAAACATTTTCAATTTTTTTAAAGACTCGACGCAAGCTGAAAA
        TTAGGGGCACATATTAAAATACAATTAAATACATTTATAAATATATATGAATTTGAAAATTTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0089640
        2128
        FBtr0089636
        2457
        FBtr0344709
        2561
        FBtr0344710
        2453
        FBtr0344711
        3145
        FBtr0344712
        2484
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0311041
        21
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088583
        594
        FBpp0088579
        594
        FBpp0311042
        21
        FBpp0311043
        22
        FBpp0311044
        22
        FBpp0311045
        22
        Comments

        Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide (may be non-coding isoform).

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG11266-RH
        Caper-RH
        Secondary FlyBase IDs
          References (0)