Open Close
General Information
Symbol
Dmel\Caper-RL
Species
D. melanogaster
Annotation Symbol
CG11266-RL
FlyBase ID
FBtr0344712
Feature type
Associated gene
Evidence Rank
Length (nt)
2484
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 64 )
Sequence
TCGATAAGTTCTGTGACAACCCTGAAGCCGAAAACAAGCAGCCACGCTAGAGAAGAAAATCTGGTTGAAAATTGGCAAAA
ATTCTAATTAAAAAATCGCAAAAGCCAAAAGAGAAGTTCACACCGAGCAGGGGACTTTTTTCACGGAGCACCCCGAATTG
CAGCGAAGTAATTTTCGAATATGGCCGAGGACTTTGATGTGGAGGCGATGCTCGAGGCGCCGTACATGAAAAACATATAC
TCCTCCTAACTTGTCTGGGGCAGCAGGCAGCACTACTACTACTCTCACTCACAGTCAGACAAGAATGAAAGTATCGCTCA
AATTACAAATTACAGATTTACGATAAACAGAAATCGAAATATAAGAATATATGACCAACACATAAGCCCAAAACGCAAAG
CCAAAGCCTAAAACAAACCAAACCTATTTGAACAAACAAAAAACACGACGTCTTTTTGAGAACCAATCAACCAGTCCACT
CCACTAGCCAGCGCTAAACATTCCCCCAAAACTGATCTGATTGAGAATGAGAATGAGCATGGGAAATTTGCCCATGTGGA
GACAACATTTCTCGCCGTCGTGAACCATCTAATGTCAGTGCGGGCAGCGGTGGAAGTGGTGGACGCAAGCGCAGCGGCAG
CAGTCCAGGCGGCGGCGGTGGACACGATGACGACTACGCCGAGAATGGTCCGCGGAACGGCAGCGGCGGCGGAAGCTCAC
ACAAAAAGCAAAGCAAACGATCCCGGAGTAGAAGCGGCTCGCGTGATGGCAAATCTCGACGAGATCGCGGCAATGAACGC
AGCAGTCATCGGGACAAGGATAAGGAGCGCGATCGTAACCGCGACGGCGGCGACCGAGATCGACACCGCAGGGAAGGTGG
CGATCGAGATCGGGAGCGGGAACGTGAGCGCGAACGCGACAGATCTCGTCGGAGTCGTTCGCGTGATGAGCGCGGTGGAG
GTGGTCGCTACGGCGATCGTGACAAGGATCGCCGCTCGCGAGATCGACGCGGCGGCAGCAAGTCGTTGCAAGTGGATCGC
TCGCGGGACAAGCGTCGACGCAGTCGTTCCCGCGATCAGCAGCGCAAACGGCTGAGTCCGATCCGTGAACGCAAGCGCAG
CCATTCCCGCTCGAGGGACAGAAATAGCCGCCGTCGGGGAACCAATTCTCCGCGACGCCGCTCACCACCGAATGGAGCTG
ATCGCACCACGCCCACCGAACTCAGTCCCGAGGAGCGGGACGCCCGCACCGTTTTCTGCATCCAGTTGTCGCAGCGAGTG
CGAGCCCGTGACCTGGAGGAGTTTTTCTCCAGCGTCGGCAAGGTGCGCGACGTGCGTCTAATCACATGCAACAAGACGAA
ACGCTTCAAGGGCATTGCCTACATTGAGTTCGATGATCCTGAGTCCGTGGCACTGGCCCTGGGCCTCTCTGGCCAGCGGC
TGCTCGGTGTACCCATCATGGTGCAGCACACGCAGGCTGAGAAGAATCGTCTCCAGAATGCAGCGCCGGCATTCCAACCG
AAGAGTCACACGGGTCCCATGCGCCTCTACGTGGGATCACTGCACTTCAACATTACCGAGGACATGCTGCGGGGCATATT
CGAGCCCTTTGGCAAGATCGATGCCATTCAACTGATCATGGATACGGAGACGGGCCGATCCAAGGGCTACGGCTTTATCA
CGTACCACAATGCTGACGATGCCAAAAAGGCTCTGGAACAGCTGAACGGCTTTGAACTGGCCGGTCGGCTCATGAAAGTG
GGCAATGTGACGGAGCGACTGGACATGAATACCACCTCGCTGGACACCGACGAGATGGATCGCACGGGCATCGATCTGGG
TGCCACGGGACGTCTGCAGCTGATGTTCAAGCTGGCGGAAGGAGCCGGTTTGGCAGTGCCCCAGGCGGCTGCCAATGCGC
TGCTGGCTACAGCACCTCAACCGGCGCCGTTGCAGCAGCAGGAGGTGGCACCATCGATAGCCACACAGTGCTTCATACTG
TCCAATATGTTTGATCCGCGTACCGAGACAAATCCTACCTGGGACGTTGAGATCCGCGACGATGTGCTGGAGGAGTGCGC
CAAACACGGCGGGGTGCTGCACATCCACGTGGACACCATTTCGCACACGGGAACCGTGTATGTCAAGTGCCCGAGCACAA
CGACCGCAGTGCTGGCAGTGAATGCACTGCATGGACGCTGGTTTGCCGGTCGAGTGATCACGGCGGCCTACGTGCCCGTG
ATCAACTATCACACCATGTTTCCGGACTCCATCAACGCCGTCGATCTGGTGACGTCCACGCGCAAGAACACCGACGATTG
AGCTGAATGCGTGGGCAAAAATATTGTTAATATTCGTTACAAGAACTAATTTTTGGTCAAAACATTTTCAATTTTTTTAA
AGACTCGACGCAAGCTGAAAATTAGGGGCACATATTAAAATACAATTAAATACATTTATAAATATATATGAATTTGAAAA
TTTT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089640
2128
FBtr0089636
2457
FBtr0344708
2623
FBtr0344709
2561
FBtr0344710
2453
FBtr0344711
3145
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0311045
22
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088583
594
FBpp0088579
594
FBpp0311041
21
FBpp0311042
21
FBpp0311043
22
FBpp0311044
22
Comments

Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide (may be non-coding isoform).

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG11266-RL
Caper-RL
Secondary FlyBase IDs
    References (0)