Open Close
General Information
Symbol
Dmel\tau-RC
Species
D. melanogaster
Annotation Symbol
CG45110-RC
FlyBase ID
FBtr0344743
Feature type
Associated gene
Evidence Rank
Length (nt)
2459
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 22 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AATCAGTTGAAATCGAGATAACAAACCGACAAGCCGACCGAGCGGGAGCTGTCTCGCTTTTTTTAAAAATTTGCACCAGC
      AAAAATCCAAATAAATTAGCAGAGTGCCAGTGAAGTAAGTGAGCGTGAGTGCGCCAAGTCAAAATATAAATATTGTCATT
      TACGCCGTTTCAAAATATATTTCCGCGAGCATTTCTCGAATCGAAAGTGAACCCAAAATATATTATTCCAAGTGAAAAGG
      ACTAGCCCAAAGATACACACACACACACACAGGAAAAATACCGACAGATCTGTAGTCCTTTTCGAGTTTTCCCGTGAGTG
      CAACAAATACAGACACACCACACACACACTCGTTCGACTTTCAATATGGCGGATGTCCTGGAGAAAAGCTCACTGCTGGA
      TGCTGTGCCACCACTAGGCGACCCCCACCCACCGCTGCCCCACCAGCAGCTGCAACAGGAAGCAGCAGCAGCAGCAGCAG
      CAAATGCCGCACCACCAGCACCACCGCAGCAGCAACAACCACCACCCCATCAGCTGCAGCAGCAGCAGCCGCAACAACAG
      CAACTGCAACAGAAGCCAGCAAATGCGAGGGCTAATCAGGATCAAAAAGAGGGCGACAATGACAGCGGCGTGGATGAGTC
      CACTCAGGAGAAGGATCGCAACGGACCCAACTCGCCCAGTTCGCCCGTAAAAACGCCCACATCGACCTCATCGAAGCCGG
      ACAAGTCGGGCACGTCGCGTCCACCGAGTGCCACGCCCTCGAACAAGTCAGCCCCCAAATCGCGCAGCGCCTCCAAGAAC
      CGCTTGCTCCTCAAGACCCCAGAGCCCGAGCCAGTGAAGAAAGTTCCAATGAACAAGGTACAAGTCGGACATGCGCCTTC
      ACCCAATCTGAAGGCGGTACGCTCCAAGATCGGATCCCTGGACAATGCCACCTATAAGCCGGGTGGCGGCCACGTGAAAA
      TCGAGTCCAAGAAGATCGACATCAAGGCGGCACCGCGCATCGAGGCCAAGAACGACAAGTACATGCCAAAGGGCGGCGAG
      AAGAAGATAGTTACAACAAAGTTGCAGTGGAACGCCAAGTCCAAAATCGGTTCGCTGGAGAATGCCGCCCACAAGCCGGG
      AGGCGGGGACAAGAAGATCGAGACCCTGAAGATGGACTTCAAGGACAAGGCCAAGCCGAAGGTGGGCTCGACGGCCAATG
      TGAAACATCAGCCGGGTGGCGGAGACATCAAGATCCAAACGCAAAAACTAGAAATTAAGGCACAAAGCAAAGTTGGCTCT
      TTGGATAATGTAAAGCACAAGCCCGGTGGCGGTGAGAAGAAGATTTTCGATGATAAGGATTATTTGAAAAATGTTGAACA
      CTCTGTTGCACTGACAACACCACCAACACAGGAATATATATACAATTTTTATTAGGCTAGTCATACGAAAACTAAGTGCA
      TTAAATTCGAAATTCGTACCGAGTTGCGTCCATTAGAGTTATTTATCGCCTATCGCTACTTTTAACAACCACATCATATA
      ATCGAGTTATCCGAATGCAATGCGGTTTTAAACAATATAGAAACATTCGATCCGATCCGATCCGATCGATTTGATCACTC
      AAATCCCAGTCCACTACCATCCATGACGGCTTCTGGCGCTGATGAAAATTTAAATCAACAAAGCTAAATGCCGAAATGCA
      TGTCGAGCTGTATCTGAAACTGAATCTGAAACTGACTCTTTCTTTGCAAGCTAAGATCAACAAAAGTGAAATATGAGCAG
      CTAATTTGAAACGTACTATCTAAGCAAAATCCACACAATGCAAAACGAGAGTTATGCGATAATTTCCACACACCCAGATA
      ATTCACAAGCCAGTAAATGCGATCAGATCAATTCGATAGAGGTGCAAGCACGCAATGAGATGCAGATACTCGTACATCTA
      CACAACCACCCCACATAGAAGCGGTATTTGGTATACAATCGAAAGTATATTTGACTAGTTGAGCAATGCACTCTTTATCA
      TCAGATAGCAGACATGAATTATATATCTCAATGTATTACCAGAACTTCATATATACATACAAATCTATATATATATATAT
      ATACATATATAAATAAAAGTATCTAAATATTTAAGCAAATTATACAAGAAACGTACGAATAAAGTGTATGCTTAGTTGAA
      AATGTTACCACTTGACGTCTAAATGTTAAACGACTAAGATAATGCAACCATTTAGATACTTTTGCGACCAGTGAAAACCA
      AAAACCAAACCCAACTGAACAGATACGAAACAAAAAACAAAACGAACCGAACCGAACAGAAGAGATAATAACACGTATAA
      GCATATTTTTACTATTAATTTGTATCTTATTAGTCAAGCGCATCATTCTCACGATTTATTTACACCCTGTTACAAAATGT
      AAGAACAATGGCAAAATTTAAGCAAATAAACAAACAAAAAAAACGTTTTTTTCATTTAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0344741
      2243
      FBtr0344742
      2425
      FBtr0344744
      1343
      FBtr0344745
      1802
      FBtr0344746
      3754
      FBtr0344747
      1457
      FBtr0344748
      1643
      FBtr0344749
      2084
      FBtr0344750
      1781
      FBtr0344751
      1803
      FBtr0344752
      2261
      FBtr0347394
      3340
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0311075
      349
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0311073
      361
      FBpp0311074
      361
      FBpp0311076
      93
      FBpp0311077
      403
      FBpp0311078
      717
      FBpp0311079
      288
      FBpp0311080
      350
      FBpp0311081
      308
      FBpp0311082
      278
      FBpp0311083
      278
      FBpp0311084
      367
      FBpp0312546
      375
      Comments
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG45110-RC
      tau-RC
      Secondary FlyBase IDs
        References (0)