Open Close
General Information
Symbol
Dmel\ATPsynβ-RD
Species
D. melanogaster
Annotation Symbol
CG11154-RD
FlyBase ID
FBtr0344754
Feature type
Associated gene
Evidence Rank
Length (nt)
2048
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 816 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      Sequence
      CACACTTCTCAGTTAGTTCGAGAAAAATGTTCGCGTTACGTGCTGCATCTAAAGCCGATAAGAATTTGCTGCCATTCTTG
      GGGCAATTGTCTCGTAGCCATGCTGCCAAGGCTGCAAAGGCTGCAGCTGCCGCAAATGGAAAGATTGTGGCCGTAATTGG
      TGCAGTCGTCGATGTCCAGTTTGATGATAACTTACCGCCCATTCTGAATGCCTTGGAAGTAGACAACCGTTCTCCTCGGC
      TCGTGCTAGAGGTGGCCCAGCACTTGGGAGAAAATACCGTGCGCACTATCGCCATGGATGGTACCGAAGGCTTGGTTCGC
      GGACAGAAGGTTCTCGATACTGGGTATCCTATCCGAATTCCAGTTGGTGCCGAAACACTAGGACGCATCATTAATGTTAT
      TGGTGAACCCATTGATGAGCGTGGACCAATTGATACAGACAAGACCGCTGCCATTCATGCTGAGGCTCCTGAATTCGTTC
      AGATGTCTGTTGAGCAAGAGATTCTTGTCACTGGAATCAAAGTCGTCGATCTCCTGGCTCCATACGCCAAAGGTGGTAAA
      ATTGGGTTGTTTGGAGGTGCCGGTGTGGGCAAAACTGTGTTGATCATGGAGCTCATTAACAACGTGGCTAAAGCTCATGG
      TGGATACTCGGTTTTCGCGGGAGTTGGTGAACGCACTCGTGAGGGAAACGATTTATACAATGAGATGATCGAGGGTGGTG
      TTATTTCACTAAAGGACAAGACCTCAAAGGTGGCTCTCGTATATGGGCAAATGAACGAGCCGCCAGGTGCTCGTGCCCGT
      GTTGCTCTAACTGGACTGACCGTTGCAGAGTACTTCCGTGATCAAGAAGGACAGGATGTGTTGCTGTTTATCGACAACAT
      TTTCCGATTTACTCAAGCTGGCTCAGAAGTGTCCGCTTTGTTGGGTCGTATTCCCTCAGCCGTCGGTTACCAGCCAACCT
      TGGCTACCGACATGGGTTCTATGCAGGAGCGTATTACCACCACCAAAAAGGGATCCATTACTTCTGTTCAGGCCATATAT
      GTGCCCGCTGATGATTTGACCGATCCTGCTCCTGCTACTACATTCGCTCATTTGGATGCCACCACTGTACTCTCGCGTGC
      GATTGCCGAACTGGGTATTTACCCTGCTGTGGATCCACTGGATTCGACTTCTCGAATCATGGATCCCAACATCATTGGCC
      AAGAACACTATAACGTTGCCCGTGGTGTGCAGAAAATCTTGCAAGACTACAAATCACTTCAGGATATAATAGCCATTCTC
      GGAATGGATGAGTTGTCTGAGGAAGATAAGCTCACAGTCGCTCGTGCTCGCAAGATTCAGCGTTTCTTGTCGCAGCCATT
      CCAAGTTGCTGAAGTCTTCACCGGGCATGCTGGTAAACTAGTGCCCCTGGAGCAAACTATAAAAGGTTTCTCAGCAATTC
      TAGCTGGGGACTACGACCATCTACCTGAAGTTGCTTTCTACATGGTCGGCCCAATCGAAGAAGTTGTAGAAAAGGCTGAC
      CGCCTGGCAAAGGAAGCTGCCTAGATAGGCGTACTGGAAAAATCTTCAAAGTCAGCAAATCTATCATTGAATATTATGCA
      TTGAATTTGTAATAAACTTTGTAAGATCAAATTAAATTCAATACAAGCGAAGAAAAAGTTAATAAAACCTATTTAAACAT
      TACGGTATGAATTAAAAGCAAAATATTTAATGTGAAAAAGCTTCAGATTAAGTGAGTATATGGTAGTATCACCGTGAAAT
      TCTACAGGTAGAATTTAAACTGACTATTAATTTCTGCATTGGTTACTTTATATTAAAAATTACACTATGTTATCATTTTG
      ACTGACTGTCGAAAATAAACCAAACTATTAATATATTGTTTTTAATACATGAGCCGATTTCATAGACTATCAGTACCCCT
      TATTTTGCTAGGCGGCAAAAAATGTTTGGTATAACGAATTTAATATACTATAGGTAGCGGGTTCTAAAAATATTCAACCA
      ATAAAATGTTGACTGAAATATCAGAGATTAATATTAGTTTAAAAAGAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0089186
      1688
      FBtr0333672
      2026
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0311086
      505
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0088250
      505
      FBpp0305828
      511
      Comments

      Extended 3' UTR based on RNA-Seq and/or EST data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      ATPsyn-β-RD
      ATPsynβ-RD
      Secondary FlyBase IDs
        References (0)