Open Close
General Information
Symbol
Dmel\Fis1-RG
Species
D. melanogaster
Annotation Symbol
CG17510-RG
FlyBase ID
FBtr0345012
Feature type
Associated gene
Evidence Rank
Length (nt)
557
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTGGATGGTGAAGTTACCACAGACACAAAGTTTGAGTACGCATTCCTAAATCTAAAAACATTAAAATATCTCAATTCTTC
        TCAATTCTAATGACACAATAGGGAATTATGATTTTGGAGGAACTGGCTCGTACGCATCCAGATGGAAGGCGTGACTATAT
        ATATTATCTTGCGTTTGGTAATGCTCGTATCAAGGAGTATACGTCTGGCTTAAAATACTGCCGAGCTTTTCTTGACATCG
        AGTCAAATGATCAAGTTCGCTCCCTAGAGGAATATATTAAAAAAGAAATCGATAAGGAAGTGGCAAAGGGTATGGTGGTT
        GCAGGCGGAGCAGCTTTAGTACTTGGCGGAATATTAGGACTTGGCATTGCTATGGCTAGAAATAAACAAAAACGGGAGAA
        ATAGTAACGTCACCACTATTTAAGGAAAATAAAACATCGAAAGGTGCACATCAAGATGTTATGAAGTTTAATACTTGAAA
        TATGTTAATTTACTACATCAACATTCTAATTAATCTTTATGTACGGTTAAATCAATAAATTATCCAATTGTTGCTTG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0086073
        630
        FBtr0273208
        698
        FBtr0273209
        560
        FBtr0273210
        628
        FBtr0273211
        704
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0311263
        98
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085409
        98
        FBpp0271716
        154
        FBpp0271717
        92
        FBpp0271718
        148
        FBpp0271719
        92
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Fis1-RG
        Secondary FlyBase IDs
          References (0)