Open Close
General Information
Symbol
Dmel\CG42724-RL
Species
D. melanogaster
Annotation Symbol
CG42724-RL
FlyBase ID
FBtr0345075
Feature type
Associated gene
Evidence Rank
Length (nt)
4153
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 54 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    AAACTGGATTGTATTCACATCTCTAGCGGCAGAAAAGTGTAGAAAATTTTCAGGGGTTTTTAAAACGAAAAGTAAGAGGT
    TGCGTACAGTTAGATTTGTGTGCCATGGATGCGAGCTTAGAGGAGAGCATGGATAGCGATGGCGCCAGTTCGCCGATTAC
    CAAGACGGAGGCAACGGAATCTCCGCCAGAAGCGGGTCTCAATGGAAACGGCAGTGGTAGTGGTAGTACCAGCCAGGAGA
    CCCCAAATTATGGCGTTGCTATACTCAAGGAAAAACCCAGCGAGGCCCATAGGAGCAAGCCCTTCAATGCGTTTAGTGGT
    CGTCCCATCGGGGAGCACACCGCCCAGCAGCAGGCGCTGCAGCAACAACAACTGCAGCAACAACAACAGCCACAGCAGCC
    GCAGCAACAAGCTCCTTCCGGAGCAAATGGAGTCACAGGACCCCCGGAAATCTGGGTGGAAACCAAGGCGGAGGACGGTC
    GCTCATATTATTACCATGCGGTAACTAGGGAAACCACTTGGTCTCGACCCGATGGCCCCGCTGTCAAGATAATGACCCAG
    GCAGAGGTGGAGGAGATGGCCAAGCGACCTGCCCAGGCCGCGAAAACGGAAGCCAAGGCAGGCGAGACGTCGGTCGAGAT
    TCCGCCAGTGTCGTCACATCTTACCTCACAACCTCCGCCGCACCTGATGAGCCAGCCACCACCCAATGCGGCAGCACCGC
    TGCTTTCCCAGCCACCACCCAATGTACGGCAACAGCCACCACCAATGTTCCAGCCACCTGGAATGCAGGCGCCTCCTGGG
    TTCGGACAGCCGCCGTTTTGTATGCCACCTCCAACTTACGGATTTCCTGGAGGACCGGCACCAGCTGGGGCACCTTGGGG
    CGTGGGCATTCCGCCTTGGCAGCAACAGCAGCACATGCAAGACAAGCCAGCCAAGTCGCTAATCATTAAGCCGGGTGTTA
    TCGATCCGGCGGTTATAGCGCGAGCAGCAGAGTGGTCAGAGCATCGTGCTCCCGATGGAAGACCGTACTATTTCCACGCC
    GGTCGAGGAGAGAGTGTCTGGGAGAAACCGCAGGCGCTGAGGGACATGGAGGCCGCTCGCATGGCTGCCCACTCGGGCGT
    TGCGCCCGCTGTGGCAACAGCTCCGTCGGGACTACCACCACACTTGCTACCCAACCCTATGATGCATATGCCACCAGGAT
    CAGGGCCGCCGGGATTTGATCCGCATGCTGCTTTTGCGGCTGCTGCTGCAGCAATGAAAGCCAATTCGGAAAACACTAAG
    GCTGCACAGGCAGCTGCTTTGGAGAAAGAGGCTAAAAAGGCGGCGGAGGAGAAGCGAAAAAAGGAGGAGGAGCAGAAGAA
    GGCTGCGGCATCAGCCAAGCAAACGGACAAGAGTCGACCTGTGACAAGTACGCCCATCGCTGGAACGCCATGGTGTGTCG
    TATGGACTGGAGATTCCCGCGTCTTCTTTTACAATCCGTCAACTAGGACTTCGGTTTGGGATCGCCCCGAGGACTTGTTG
    AATCGTGAGGACGTTGACAAAGCGGTAAACGAACGTCCGGAGCAACTGAAGACTCCGCAAGAGAAGTCGGCTGAAGCCGA
    ACAGAAGTCCGGCGAGGAAGCAAATCAAGAGCAGGCTAAATCGCAAGTTCAAGCCCAGCAACTGGATCAGGTGCAGAGGG
    TGGATGCGGATGATGATGACGACGACGAGGTTATCAAGATACGCACAGAGTCTGAGTCTAGTGTGGAAGAGGTGCCAACC
    AAACGAGTTCGAATGATTTCCAAGTCGAAGCGGGCAGAGGATGCCGCCCTAGAGGCTGAGCAGCGGGCGGCCAAGGAGCG
    GGCCTTAGTACCACTAGAAATGCGCGTCACCCAATTCAAGGAAATGCTTCGAGAGAAGGACGTATCGGCTTTCAGCACTT
    GGGAGAAGGAGCTTCACAAGATCGTGTTCGACCCGCGGTATCTTCTGCTGACTTCGAAGGAACGCAAACAGGTATTTGAA
    AAGTATGTGAAGGATCGGGCCGAGGAGGAGCGTAAGGAGAAGCGGAACAAGATGCGCCAGAAGCGGGAGGACTTCCGCAG
    CCTAATGGAAGAAGCCAGGCTGCACGGAAAATCCTCATTCTCGGAGTTTAGCCAGAGGAACGCCAAGGATGAACGGTATC
    GGGCCATCGAGAAGGTTCGCGAACGAGAGAGTCTCTTCAACGAGTACATCGTGGAGGTGCGGCGCCGCGAAAAGGAGGAC
    AAGCTGTTGAAGAAAGAGCAGCCACTAGCTAGCAGGTTACAGCACAAATGCACCACCCAAAACACCAAAATACACAAGAG
    CAACAGCATCGAGAACCACCTGTACAACACTCTCGACGGTCTATTCCGCCCGCCGTCTGCCATCGCCGTCCACTGATCTA
    CTTGACCACGCACATGTTTGCAATCTGTGTGGTGAGTTACTTGAAACATAACAAGCAAAAACATTTAAATTTGTTTTTCT
    GCAATAAGAGACAAATTTGGAAAAAAAAAAAACAATTATAAAACCAATATAAACAAAACTATCGAAAGGTTGCCAAACTG
    AAAATTACCTGATAATCGTTGGTGTGATTTCCACTTCCCGAACTACGCCCCACGTCGCCCCTCTCGGATGTTTTATGCGA
    TGTGATGTGATGAAGAGGATGTTGCGATGATGTGATTGGCATTGGGATCATGATTGATGATGTTTGAAGTTCGCGATGGG
    CTCTCGGAGGGATGTCGCCGAGCAGGAAGCAGGCAGAAAGGGATTGTTCCAGAGATCCGGAGCGACTGCAGTTCGTGTGC
    AGGTGTCTGCGGCGCTAAGCAAACAATCCGCAAGGACTTTCTGGATATGCTGCGAGAGCGTCACGACATCGAGCGCCACA
    CCAGGTGGTACGACATCAAAAAGAAGTTTGAGTCGGATCCACGCTACCGTATGGTGGACTCCATGTACCGGGAGGAGTAC
    TTCGAGGATTACCTGCACATTATGAAGGAGGAGAAGCGAAAGGAGCGGGAGATGCGTGAGCAACGGGAACGGGAGCGACA
    TCGCGAACTTAAATCTGATCGGAAGGAGAAGGACAAGGAAAAGGACAAGGGTCGGAAGGATCGAGGACGCAGCCGTTCGA
    AAGACAAGGACCGCGAGCACAAGTCATCCAAAGAAAAGGATAAAGACAAGGAGGAAAAAAGCAAGTCGGAGAAAAGCAAG
    AAACGAGATACCACCCCAGAGGAGGGTGAACATCGTGAAGAGTCAGAAAGGGAAGAACGAGCCGGCAGCGACGACAGCGA
    GGTGGCTCGCCAACGGGAGAACGAGGCTGAGCAAAAGCAGAAGGAACGCGAGAAGAAGCTAAGGGTAGAGCAGAGTATAA
    GGGAACGAGAGAAGGAGGTGCAGCGAACCCTGGCCGGTCATTTGAGGGATCGGGACAAGGAGCGCGAGCATCACATGCGC
    GAGGAGTGCATTGGTCACTTTACCGCTTTGCTGACAGATCTGGTGCGAACGCCGGACTTCACGTGGAAGGAGGTCAAGCG
    ACAATTGCGGAAGGATCATCGCTGGGAACTAATAGAAAGCCTTGATCGCGAGGATCGCGAGCGAAAATTCAACGAGCACA
    TTGACAATCTGATGAAGAAGAAGAGGGAGCGATTCCGCGAAATGCTCGACGAGATTAGCACTCTTCAGCTTACTAGCACT
    TGGAAAGAGATTAAGAAGCTGATCAAAGAAGATCCGCGATACCTAAAATACAATTCGGACAAGGGCGAGCGCGAGTTCCG
    GGACTACATCAAAGATAAAACGATGACAGCGAAGACTTCTCTTCGGGAACTCCTGCAAGAGTGCAAATTTATTACTCACA
    AGAGCAGCGATCTCATCAAGGAAAATCCAAACCATCTCAAAGAGATTCAGGACATTTTGAAGAACGACAAGCGCTATTTG
    GTGCTCGATCACATGGAGGAGGAGAGGAACACTATTGTGCTCGGCTTTTTGGAGGAGCTCAACAAACGCGGCCCGCCGCC
    ACCACCCACAGCATCTGAGTCAACGCGCCGCAACAAGTAGAGTGGCATTTTAAATAAACTAATCAATTAAATCATAACAA
    TTAAATTATTATACTAAGACGAAGTTCCGCATCTTCGAATATTTTAATTGAATAAAATACACACATTAAAGCG
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0303013
    3688
    FBtr0303014
    2500
    FBtr0303015
    2805
    FBtr0303017
    4036
    FBtr0334545
    3589
    FBtr0345076
    5245
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0311305
    763
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0292135
    1123
    FBpp0292136
    763
    FBpp0292137
    669
    FBpp0292139
    763
    FBpp0306612
    1123
    FBpp0311306
    761
    Comments
    Transcript terminates at site supported by polyadenylated cDNA.
    Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.
    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (1)
    Reported As
    Symbol Synonym
    CG42724-RL
    Secondary FlyBase IDs
      References (0)