Open Close
General Information
Symbol
Dmel\CG42404-RF
Species
D. melanogaster
Annotation Symbol
CG42404-RF
FlyBase ID
FBtr0345173
Feature type
Associated gene
Evidence Rank
Length (nt)
5536
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 13 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GAGTGCTAACTAACGCGTGCAATATGTATTTTTTGGCATTGCTTGCGTTTATTGGAAATGCCAAAGATGGAAACGCGGTG
        AGCTCGAGCCTGATCCCCGGCGGCTCCTGCCGCGATTACAATGGAAAGATGTACGAGACTGGCATGCACTATATGCCGGG
        ACCCGACTCATGCCGCCTCTGCATCTGCGACAGCGGACTGCCCAAGGCTTGCAAGATGGTGCTCTGCGAGGCGTTCAGCA
        AGTGCAAGTCCTTCCAGACGGTGGGCAGCGGCAACAACTGCTGCGAGGTGATCTGCCTGGATGACCAGTTCAGCGATGGG
        AGCACCGACTTCGGCATTTGACTGGTGGCCAGTGGCATCACGGCCACGCTCTCCTTGTCGCTTCTCTTCTTTCTGGTGAA
        TCGCCTGAGGCAGCGGAAGATGCGGGCGCGGGAGAATCGCCAGAATGCAGAGGATCAGCGCAGCATTGTGGGCAGCATTG
        GCTACATAGCCGGAAACATGGGCTACATGGAGGGTAATCTGAGTGCCATTGATTATTCCTACAGCGGCGCCGCAACCCAC
        TATCCCTTGTGGAAGCCGCATTTTCCGCGTGGTGAAGCTCCACCGCCGTACGAGGAGGCAGTGGCCATCTCCCAGGCGGA
        GGCGCTTAGTGCCCAGTGCACCGTCAGCCTACCAGCGAGCTCCCAGCGAACGGTAGCCACGGTTAGCCAGCAGCAACAGC
        AGGCAGTGGCCCAGGCACAAGCCCAGGCTCAAGCTCAGGCTCAGGCCCAACAGCAGCAACAGATCCAGGCCCAGGTGCAG
        GCCCATCAGCATCTGCAACAGCACACTCTCCAACTGCACACTCAACCGCAGCAGCACCACCAGCCGTACAGCCAGCAGCT
        TGTGGCTCATCCGCATCCACAGCACCCGCACTCCACGGCCAATGTGCTGCCCCAGTCAAATCAGTACACACAGAGCACCA
        CCAACTTAATTAACATCAACATCAATAGTGGCGGGGTGACCACCATAGCCACCGGGGAGAATCACCAGCCGCCTTACAGT
        CTGCAAAGTGACCACCAACTCAGTCTGGAACAGCAGCAGCAACAGCAACAGCAGCAGCAGCATCTAATGCAGCCTCCGGT
        CAGCAGTGGTTCCATTTGCCTCCAGGCGATGCCCAAGCCGCCAGTCTCCGCCGAGTGCAGCTACAAGAATTGCCACCTAA
        ACATTAGCGCCAGTGTTACTACTGCGGCAGCCAGCTCCAGTTCGGCAGCCTATACGTCTGGCCGAAGGACAACTCCCAGG
        GGATCCCAGGAGTTGCTTCATCAGTTGCCACAGCAGCAGCAGCAACAGCAACAACAACAGCAGCAACAGTATCTAACCGT
        AGCCGATGTGGAGATCAATGCTAGTGCCAGTGCCGCAAGTTATCATTCCCTGCCAGCAGGTAGTGGGGAACTTGTGGCCA
        CTCCCACACACGCACAAGTGTTGCAGCATCAACAACAGCAGCACCAGCAGCAGCAGCAACATCTGCTGGCGGCCATATCC
        TCTCCGGGCATGGAGATACTGCAGCCTTTAGAGATAGCCACAATCTCGTCGGCACCTGCCTGCAGCACAGCGGATTCAGT
        GACCCAGACCACACAGATGCCTCTGCACGGAACGCTGAAGAACAGCCAGCCACAGCAGATGAGCAAGACACCCTCCAGTT
        CGAGGCGCTATCACCGCACTATTCCGCGCTATTTCGCAGTGGCCGACCCTCTCCAATTAAAGCCCAAGACCAGCAGCAGT
        GCCACATCCACTGGTGATAAGCAGCAGGCCAGTAAGAAGCCCATGTGCCAATGCCCCATCCAGCACGTGCCCATGTCGTA
        TATGGGGAGTACGGCCAACGCAAATGCTTTCTTAAGCGGAGCCGGCAAACTTTTCACCGGAAACTCGACCAGCAGCAGCA
        CCTCAACACCGACGTGTTCCCTGTCTCCGGGAGCGGCGGCCACCGGTGGAGTTCGTCATGCGGCCACCTTGTCCTACGGA
        CAACGAGCCAAGTCCTCGTCGAACCTGCAGGCGCAGGATCTAATAACGGCAGCTGCTTCGGGTGGTGGAACTTTGCGACG
        AAGTGGTTGTGGACATGAGCCGAAGATAGCCACTATATCCAAGCAGGTTGGCGATGAGACGCATCATGGCCATACGGCAT
        CCAGTGGTGGAGTCAATGTGTCGGCCATTATACCACCGCCCCCGCTGCAACATCCCGAAGAGGTGTCTGCGCCGCCAATT
        GTCCTGGGTCGCGTGCAGAAGAGATCATCCAGCAATTCTGCCGAACGGGGAAGGAGCTCCAGCGGAGGAGGCAGTGGCGG
        ACGCAGTGTGTCCAGTGGCAGCGGTGGCGATTCCCTATCCAGCGTCTATTTGAATCGAAAGGTGAGTTCGAAATGTTGAT
        GCCTACTTGAGTTTGACGCAGAAACAGCAGCAACATTTCTTTAACCAGCAACAGCAGCAGCAGCAGCCAGATCCAAGCAA
        TCCGACTTTACCACCGAAACTCTACAAAAGCCTAACGAATTTAAAGAGCGCCACCGTGGTCAGCACATCCTCGTCCTCCT
        GCTCGTCCGGCAGCGGGAACAACAACGCCGTGGCCACCATTTACACGCTGAGCAAGCCGGCGACCAGTGGTCAGCGCAAG
        GAGCAGACTCCCTCGCTGACTCTGCCGCCGGCCAGTCCAGCCGCAGGACAGTCCGGCGAGAAGCTGACCAGCGGCAAGAT
        CAACTCGAGCACCTTCTATCCGTTGGCCAATCACGTGACCTACACCCTGCCCAAGCACATCAGCGGCAAAGTGTCGTTGA
        ACAGCACCATCAACAGCGTGGTCAGCAAGGTGCCCTCGGTGATCAGCATTCCGCCAGTGGAGAACAACAATCCGGGCGGC
        CAGACAGGAGTGCCGGCCAAAAGCACCACACTGCCAAAGATCCTGCGCGTGAAACGCGATCCATCGTCGGGGTCGGGAGA
        AGGGGGGACTGCCACGAGTCTGGCGATTGCCCACTGCCAAATGCCCAGTTACCCGCTGACGACGAAGGCCACCAACGGAG
        GAGGAGGATCCACCGGACGGTCGCCCAGCAAGCAGCTACCCGTGTGCACCACCTCGAAGAACTGCCTAAATCCCAAGGAG
        CACTTCCTGCCCAACGACACCAGTCTGGACGATGACTACCTGAGCGAGTGCGAGAACTGTAAGATAGCACAGAGCGCCAA
        GTACTTCTTGGATGCGGAAATGAGCGGCGGCGGATCCGCAAACTCGCACCAAGAGACGATGACGCTGCAGCGGAAATCAC
        TGGAAGAGACCAAGGAGGAGCCCATGGAGAGCTACTATCGCAGCTCGCACACTCTGCCCAGCAATGCCAAAAAGCATGGC
        AAGAATAACAATCGGGAAAAGTGGCAGGTCTCGACGATTCCAGCTGCCAGCTCGTCGGATGAGGACATCAACGAATGAGA
        TTTAAGCCATTTTCTTTAAGATGCCCGATCGCCGGCCAGAAGAGCATCCTAAAGAAAACGCAGGCTCCAAAACCACACCA
        CATCCAACCACACCCCGCCCCCCCTGGATAGCTAATCAACGTAGGTAACCAACCAATTGCTGCTGCAACGAGAGACAGAT
        CCTGTACATATATACGAATATTAAAATAAAATCGCGTCATTAAATATTTGTAGAAGGTAACCAACTGATTGTTAGATTTA
        ACCATGACTAACGATACTCAACCCAGAAGCGGCATATAAATCTGCGTGTTTGTTATGCACCTGTATATCTTTGTACGTAT
        GTAATTGAATCTGTACCATACGATATGATATGAAACGATAGGATAAGCAAAGTTAGAGCGGGCATTAAATCAATTATAAC
        CAATGTATTATGAAGATATTAGCGGAAATGTTGAATACTTAGCATATATGAAATTGATCATTAAGATGTCAAACCCTACT
        GCCATCTGCCATTTTGCCAACGTTAACTGTCAATAATTGTGTATGTATGTAATATTTAAATAATGAATGTAAGAAACTCA
        AGTTTTTATATACAACTAAAGGAAGCTGACCAAAATTCAATGTATTTCCCTGCTGCTCATTCCCAAAAGATGCACAAACA
        TTGCACATACGAAATCTAGGATAAACCAATTGACATAGGCATACATACTCGTAAATAGAGGAAACCATAGGATACGAATT
        TAAATTGAAAACTCATTATCATTTTATTCCCGCTTTATATAAGACGTCGGCAAACGTACCGACCGACAAATGCTTTTCTA
        ATTTCCAAAGTTTCCATCTTTTACCAGTCGAATCAATGAATGTACCATATAGAATGAAACTGCATACATCAGTATGCATT
        TAGGCGTAAGAAATCGTTTTCAGTCGTTTTTGTGTGGGGTTTAATAGACATTAGACGGTTTCCTGATCGATAACGAAGGA
        CTTGCTAGAGAATAACATTCGTTTAATTCTTGAATTGGGCGGGTCCTAGACAGTCTAATGCCAACGATATAAGCACGATA
        TGAAATTATATGTATGTACATGGAATACAGATAGAAGAGCAGCGCTCCACGAGAAGTGGGCGAATGAATTCTTTAATTCA
        ATTTGCTAGTTACTAGTCGTAACCACACTAAGCCAAGCGCGTTACTCAAGCAATTAGTCGAAGCCAGAGATACCCCCAAT
        AAAATACATAGATACTACTCAGTAAATTATCCTGGTTTGTCCTGCCCTTAGTTCTTCTTTAAGTTAAGCTACCCCCATCC
        CACTTACTGCGGATGGACGGAGATGGATGAGGAAAGCTTGCTCGAAAACGGTTCCTGTTCCGCTTTTGGTTGTAATAGAT
        CTCTGACCTGAAAACTGTATTGTGTTCAACGGATGCTCAAAAAAAAAAAAAATAAATAAACGAAACAACATAGCTATATG
        CCGACCGACAAGCATGAATTGTACAATTTGTTGTTTAAGTTCGGATATTGTATGTATGTTCAACGAAGACTTGACTCTGT
        TATCAAATGCTCAAAGCGTGTACTGACCACAACGCAATCGTGTTCCCCAATTTCGGGGGCGTAATTTAGCAAACTGAAAA
        TACAAGTATTACAGAAATTACTCAATAGTATTAACGAATGAAATCAAACGTTTTTCAATATATGTACTTATTAGTGAGAG
        TCATTTATCAAAATTTAGTTTCAACCGTAAAACCAAAACAAACAAATATGTACATCACGGCTAAGTACGAATTTTTATTC
        AATAAGCTATATTTACTAATAAACAAAGTCTCAAGAAACCAAATATTAAACTAAAAAGTACTTGGTAATAGTAGTTTAAA
        ATTACAAAAGGATAAAAATACATTAAAATTAAATTAGTGTGCTATAGTTAAAACAAATTTACCAAATCGAAAAAGAAAAC
        GTTTCAAAAATTATTCAACACAATCGATGTCGAAGTCGAATCGCTGCTGACGGACATTGTGTTTCAAAAACGATATTGAG
        ATTTGTATGAATAATTGCTTAAACAACAGAATATTACGAGTATCAATGTGTTATTGAAAAAACATCGTATTGTAACTATT
        TAAATTTAATTGAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0305613
        4825
        FBtr0305614
        5523
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0311382
        105
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0294061
        1133
        FBpp0294062
        1133
        Comments

        Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG42404-RF
        Secondary FlyBase IDs
          References (0)