Open Close
General Information
Symbol
Dmel\Sec31-RD
Species
D. melanogaster
Annotation Symbol
CG8266-RD
FlyBase ID
FBtr0345224
Feature type
Associated gene
Evidence Rank
Length (nt)
4148
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 56 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GGCTCAGAGCACGGTCACACTGGCCGTTCCTACGGTTCTTAAAAATATTAACGATTCCAGTTAAATTCAAGATCAAAAAG
          TCTCGTTGCAGCGCAAGCGAGTACAAATTGCATTCACAATTGTGTCACGAAGGGACATTGCAAGATGAAGATCAAGGAAC
          TGCAAAAGACGGTGAACATCGCCTGGTCGCCGGCGCAGCAGCAGCAGATTCTCTTGGCCGCCGGCACCGCCGCCCAACAA
          TTCGATTCCAATGCCAATTCCACTCTGGAGTTGTACTCACCGAACTTCAGCGATGCCACATACGATCTGGAGCTGAGGGC
          CAGCGTTTCCAGCCAGTACAAGTTCCAAAAACTCATCTGGTCCCCAGTGGGACCACACCCCAGTGGCCTGATTGTGGGCG
          GCTGCGAGGCGGGGCAGATCAACATATACTCAGCCGACAAGCTGCTTGCAGGCAAGGAGGAGCCGCTTCTGAAGCGCCAG
          GACAAGCACACAGGCGCCGTTAGCGGGTTGGACTTCAATCCCTTCCAGAACAACCTGCTGGCCTCATGCGCCTCCGAATC
          GGAAATCCTAATCTGGGACCTCAACAACCCGGAAACAAGCATGAGTCCCGGCACCAAGACACAACCACTGGAGGACGTAA
          AGAACGTAGCATGGAACAGGCAGGTGCAGCACATTCTAGCCTCCGTGTTCAGCACACGCTGCGTGATTTGGGATCTGCGT
          AAGAGTCAGCAGATCATCAAGCTCTCCGACTCGCAGTCGCGAGTGAGGTGGCACGCTATTGAGTGGCATCCGGAGGCGGC
          GACGCAGGTGTGGCTGGCTTCCGAGGACGACCAGGCGCCAGTGGTGCAGCTGTGGGATCTGCGATATGCCACGGCTCCAG
          CCAAAACATACCAGATTCATGAGCGCGGAGTGCTGGGAATGTCGTGGTGCCTGCAGGACAACGATCTAATGGTTTCGTGT
          GGCAAAGACAACCGCATCTATTGCTGGAACCCCAATACCAAGATTCCAGAGGGAGAAATCCTATCTGAGGTTGCCACCAC
          TGCCTCGTGGTACTCCGATGTGCAGTTTTGCCCACGTAATCCAGCTCTGATAGCTAGCGCCAGCTTGGAGGGAGCAGTTT
          CCATTTACTCTCTACATGGAGGCACTCACCACCTTGTGCAAACCGCCAACAAGATTGCCGACTCGTTTCCGGGCATGGAT
          CAGTTTGCCCAGGAGCCAATTCCGCAGCAGGCCACGCAAGTGGTTTACCATGACCTGGCGCACGCTCCCAAATGGATGAA
          GCGGCCCTGTGGCGTTGCCTTTGGATTCGGTGGCAAGTTGGTCAGTTTCAATGGAACCTCGAAAACGGTCAAGGTCCAAC
          AGCTAACCACCGAATCCGCCCTTGTGGACCGGGCTAATGCCCTGGAACGCTCTCTGGTCGATGCCAATTATTCGGATTAC
          TGTCGGCAGCGAGCAGACGAGACACCGGATCAGCATGGCCGCTACATCTGGTACTTTATTAAGGCGAACTTCGAGCTTAA
          TCCCAAGGAGGAAATGCTGAACCTTTTGGGCTACAACAAAGACGACATCGATAGCAAGTTCAACAAGTTTATCAAGGAAA
          CGGATGGCAACTCGCATTCGGATGTGGATACTCTGACGACCCGCATCTCGACACTGACCCATAGCGACTCTTCTGAGGTC
          GAGTGTGATCAGAGTACTAACTATAGCACCGATAATTCGCAGACGCAAGATAACAAGTTTGATGGCAATGCAATCGACTC
          ACAAAATCACAACGACTTTGCCACTCCTCCGAGGCCGCAATTCAAGGTTCCCAGCGGAGACCACTCGGATAGCCTGATTG
          CCGAGGCAATACTCACTGGCAATGTGGACGCTGCCGTGGAGCTCTGTCTGGAAGCACAGCGCATTCCTGAAGCCCTGATT
          ATCGCCTCAACGGCTGGCATTGAGACTCTGAACCGCACGCAAACGCGCTACCTGCTGCAGCAGAAGAACGAGCTATCGCA
          CGTTATCTCCGCTTTGGTATCGCGCGACTGGTTGGACTTCGTCAACAGATGCACTGTGGACTCGTGGAAGGAGGCCCTGG
          TGGCCGCGCTCAAGCACAGCGAGCGCAAGGTGGTGGACATCTGCGAGCGACTAGGCGATCGCCTCTTAAGTGAGTGCGCC
          TCAAGCGCCGAGTTTACGCGCAACGCCATGCTCTGCTACATTTGCGCCGGCAGCATCGACAAACTGGTCACCGCGTGGTA
          CCAGTTAAAGCGGCTGGAGCAGCAGAACCCCGGCTACAAGCCCAACACCACAGAGCTGCAGGACTTGGCTGAGATGGTGA
          TGCTGATGTGCAAGTCGTTGGAGCAGCAAGGCATATCCGTGGACTTGGCTGGTCGCTTTGCCGGCTTTCTGACTGAGTAC
          GGCGGTCTTCTTGCGTCCCAGGGTGCTCTGACTGCAGCCCTGCAGTACATTACCACCTTGGGCGGAGGAGCTGCCGCCAG
          CGAAAGCGATGTTCTGCAGAGCCTACGAGACCGGATAAATAACGCTGTCAACCTGGACTACACCCAGCCACAGGCAGCAG
          TCGCTGCTGCGCCACACGGCTACCAACCGACTCGTGGTCGTGGATCGTTCTCGCAGCCACAGCCTTCGGCTCCCATGCCC
          TACGGCCAGCCGCCCAATCAGTATGCACAGCCCAGCTGGCCAGCGCAAGTGCCTCCACTACAAACAAGCTACCCAGGAGC
          CCAGCAGCCTCAGGCTCCGCCGCAGATATTCAATCCGCAGCCTGTGAAACCAGAGCCCCTGGCCCAACCACCGCGCCCAC
          TCAGCAATGCCAGCTCTTCAGGTGGTCCGCCGCCAGCAGGCGGCGCATCATCCTCCGGCGGATCGGGTCTTTCTGGCCGC
          TCCAAATACGTTTTGGACCCATCTGTAGCAGCTCCAACCAGTTCCTACGGAATGCCATACAATCCAGTGCCGGCCCCCGT
          TCCATCAGCGGTTCCATTTGGCGGCGGAGGAGTGCCTGGGCCCGCACCCCAGCCAGCTAGCGTGCCAACGTACAACAGCA
          ACGCGTTCAACACGAATCCTATTGCGGCTGCCCAACCTTACAACCCTTCGCCACTCATGCCAGCTCAGCAGAATCAGTTC
          GTGCCCGGTGTGAATCCCATCGAGACAATGCCACCGCCGGCTGTGCCACCAGTCATCCAGAATGTGCAACGCAATCCCAC
          ACCACCACCTGGCTGGAACGATCCTCCTGCACTGAAATCTTCGCGAGCGCCTAAGCCGAAGCCGGTGGTTGAGCCAAGTG
          CTGCTATCTTCCATCCCCTGTTCCCAGTCGACCCGAATCAGAACCAGAACGGTTATGTGGACCCCTCTCAATATCAGCAC
          GCAGCACCACTTGGAGGAGTGCCCAATACGTACTACAACCCGGCTGCCTTCAACAACAATCCCCAGCAGCAGCAGCAGCA
          TCAGCAATCATATCTCCAGCCTCAGCAGCCAGCCCCTGGGATTCAGCAGCCAAACTGGCAGGGACAACAGCAAACCATTG
          GCTATACCGAGCAGCCAGCGCCCATCCAGCAACAGCGCCAACCGGCGCCGCCCAAGGAGAAGCCACCACTCCCCGAGGAG
          TACATCTACTTGCAGACTGTGCTGGAGGAGCTGAAGAACCGCTGCCTGGGCGCAACCAATGATCCGCGCACAAAACGAAA
          GTTTGTCGATGTTGTCAAGAGGCTCGAAAATCTCTACGACTGCCTGAGAGATGGAAAGCTCACTCCCACCACGGTGCAAT
          ATCTGAATCAAATAGTTCAGTACATTCAAATATCCGACTATGCCAATGCTATGGAAATCCACACGCAAATCGCCTTCGGA
          ACGGACTTTGCGCAGTGCGCGGGCTTTATGCAGGGACTGAAGGTCCTACTGCAATCCGCATCCGAGCTACAGTTGGTTCT
          GCGTTAGAGCCCCGTCGCCGGATCGCAGCCAAGTTCACTAAACGTATATTCTTATTGTGTCTTCAGATATCGATGTCAAA
          CACAAAATGTTTTGTATACAAAGAGTGGTTCTCTACGTTAGTTTAGGCTGGGATCACCAGAAGATTGTCAACGTTATTCC
          GTGTATTGAAATATATTTCCACTTAAATCGCAAATAGACATATGCATAAATAACAAAACGAACATTGT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0088642
          4088
          FBtr0088643
          4091
          FBtr0339302
          4145
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0311417
          1260
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0087723
          1240
          FBpp0087724
          1241
          FBpp0308410
          1259
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Sec31-RD
          Secondary FlyBase IDs
            References (0)