Open Close
General Information
Symbol
Dmel\inv-RE
Species
D. melanogaster
Annotation Symbol
CG17835-RE
FlyBase ID
FBtr0345673
Feature type
Associated gene
Evidence Rank
Length (nt)
4776
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 8 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CAGTTCGCGAGAGAATCAGTTGGTCGGCGGTTCGTAACAGCGCACGTTACGTTTTTAACGGACGAGCGGATTAACGTCGG
        TATCGACAAGTTTATCACCCAACCCAAAAACCAATTGTCAATCGAAGACGATAGCGCGGCGTATTTGCCAATCCAAGTGA
        TATCTTTTGGCTGTGGTTAATGTTTTTAATGCTTTCTGGCTGCCCTGAAATGCCGTCGGCTTTTGGTCCCTGTGAACTTT
        CGAGCTGAAGACCTAAGCCCTCAAACTGATGTCCACCTTGGCCAGCACTCGACCGCCCCCGCTCAAGCTGACTATTCCTT
        CCTTAGAGGAGGCAGAGGACCACGCGCAGGAGAGGAGAGCGGGCGGAGGTGGCCAGGAAGTAGGTAAAATGCATCCGGAT
        TGCTTGCCCTTGCCGCTTGTCCAGCCGGGCAACTCGCCCCAAGTGCGGGAGGAGGAGGAGGACGAGCAGACGGAGTGCGA
        GGAGCAGCTGAACATAGAGGATGAAGAGGTCGAGGAGGAGCACGATTTGGACCTGGAGGATCCGGCCAGCTGCTGCAGTG
        AGAATAGTGTCTTGAGTGTGGGCCAGGAACAATCGGAAGCAGCACAGGCTGCGCTATCCGCTCAAGCTCAGGCCAGGCAG
        AGGCTTTTGATCAGCCAAATCTATCGACCGTCGGCATTCAGCAGCACTGCTACCACTGTTTTGCCGCCCAGCGAAGGTCC
        GCCCTTCTCACCCGAAGATCTCCTGCAACTGCCTCCCTCCACTGGAACCTTCCAGGAGGAGTTCCTGCGAAAGTCCCAGC
        TGTACGCCGAGGAGCTGATGAAACAGCAGATGCATCTAATGGCCGCCGCCAGGGTGAACGCTCTCACGGCAGCGGCGGCG
        GGAAAACAGCTGCAAATGGCAATGGCGGCGGCGGCGGTTGCCACAGTGCCCAGCGGTCAGGATGCACTGGCTCAGCTGAC
        GGCCACGGCATTGGGTCTGGGACCCGGTGGAGCGGTGCATCCCCATCAGCAATTGCTACTGCAAAGGGATCAGGTCCACC
        ACCATCATCACATGCAGAATCACCTGAATAACAATGAAAATCTGCACGAAAGGGCGCTCAAATTCAGCATAGACAATATC
        CTGAAGGCGGACTTTGGTTCCAGATTGCCCAAGATTGGTGCTTTAAGTGGCAATATCGGTGGTGGCAGTGTAAGTGGGAG
        CAGTACTGGCAGCAGTAAAAATTCTGGAAATACCAATGGCAACAGATCTCCCCTAAAGGCGCCCAAGAAGTCGGGAAAGC
        CACTGAATCTGGCTCAAAGTAACGCCGCCGCCAACTCGAGCTTGAGCTTCTCCAGCTCGCTGGCGAATATATGCAGCAAC
        AGCAACGATTCCAATAGCACCGCCACCAGCAGCAGCACGACGAACACCTCGGGGGCACCAGTGGATCTGGTCAAGTCGCC
        ACCGCCAGCGGCAGGAGCGGGTGCCACAGGAGCATCCGGTAAATCGGGCGAGGATTCCGGCACTCCCATCGTTTGGCCAG
        CGTGGGTCTACTGCACCCGCTACAGCGATCGTCCCAGCTCAGGTCGAAGTCCACGAGCGCGAAAGCCCAAGAAGCCGGCG
        ACGTCCAGTTCGGCGGCAGGTGGTGGGGGTGGGGGCGTCGAGAAGGGGGAGGCCGCCGATGGGGGCGGGGTGCCGGAGGA
        CAAAAGGCCGCGAACGGCCTTCAGCGGAACGCAGTTGGCCAGACTGAAGCACGAGTTCAACGAGAATCGCTATCTGACGG
        AGAAGCGACGCCAGCAGCTGAGCGGGGAACTGGGACTGAACGAGGCGCAGATCAAGATCTGGTTCCAGAACAAACGGGCC
        AAGCTGAAAAAGTCGAGCGGCACCAAGAATCCGCTGGCGCTGCAGCTGATGGCGCAGGGATTGTACAACCACTCGACGAT
        ACCGCTGACCCGCGAGGAGGAGGAGCTGCAGGAGCTGCAGGAGGCGGCTAGTGCCGCTGCCGCCAAGGAGCCCTGCTAGA
        AGGAGGTGGGGTGTGCGGCAATATCTACAATCTAGTATTTATGGAGTAGTGTGTAAGCTAGCTTTAGAAATTCTGAGCGA
        TTAAGTTGTACAATATTCTAGTCCGCCGCACACGCAGTCGAACGCAGAATCAGGTGAAGAAATCTTCCGGAGAATTGGCC
        GCTGGGCGTAGAAATCCCCCGAAGAGCTATGATTGTGTGTGCGTTTTGTATAATAGATTCATAAATTCACAACTAAATAA
        TTTAATAAACATTTAAATTATACACGCCGTTTTTGTTGCTGTCGTTATCAAAGAATTTTGCATAATTTTAATGTGATTGC
        CATATCTGTTTATGGGCCGCAGCCAATCGAACAGTCGGCCAATTGGCCAAGTGGGTGGTCTCCATCTATAGCTTTTGCTA
        TTGATATATACATATATCGATCGCATTTCCATTTTCCGTGGGCGTCGGCATTAATTACTCAATTAACAATGCGCGGATCA
        AAAGATTGGGCACCGGCCGCAGCAATTGCTGGAATTACATTCGAATTGAATTCATTATGCAAATTGAATTTAAAACTGCT
        ATCTTCGAGCATAATCACGCCTAATAAACGGCGTCTCGTCTCGATGCCAAACATTAGCCACATATATTATTAAATTCCCT
        CCTTCGTCGCTTTGTTTTCGTCCCCTCTTGTTTCGCTCCCTCGTCTAATTTAGCCATTAAATTTGCATACAGTCGTCAAA
        TCCAGGTGTGTGCAGGTGTGTGTGTGTGCGCCAGTGTGTGCGAGTGTGTGAGTCTGCCAACGGCACAAATTGACACCTTG
        ACGGCCAAAGCGGCGCCCGCCGAGCTTTACCTTTGCTTTTGCTGTTGCTTTTGCTTTTGGCCAAACTGAAGTGCAGCGTC
        AACATCGCGTAGGTGTTAAATGTGTCTGTCATTGCAGGCGGCACGGGTTAAGCCGTCGGCGGGGGGGTGGAGAGGGCCGG
        GCGGTACAGTGGATCGCAGGCACGTAACACCTGCAGAAGTTCGAGGGGCCAAACAAAGTGGACGACAACAATAAACAACT
        GAAGGTAATGTCTAAATACAGAAAACATTTAACCACAATGGCAATCAATTTGATCGTAAATCTTCCATTTGAAAAAACTA
        CATATTTTAATATACCAAATTACCAATTTAAATTATTTTCTAATCTTAAATAATTTGAATTGTGCTTATTCAGTTAATAG
        TAAAGTTTTTAAATTACAATGCATATTTATTATTGCAGTTATTATTATTTCATCCTATAGACATTTTCTGAGAAATAATG
        ACTTATTAAATGGAATTTAGCAAAGAGTAAGAATGTTATTTAATCAAGAAGTAATACAATCATTTAGAAAAAAATAAAGT
        TTTTATTAATATTTTTGGCTTGACTGAACTTTAAAAATTCCAAGTTAACCTCTTCTTTCCCGATGAGCAACTAAAATCCA
        TTTGCAGTCCAAAAATAAAATGTATAACAAGTATAGCAAAGTAGTATATTTACCATTATGGAATGTTTAATTTGTGGCTT
        TGGCTTGCCTTTTTTGATTTTTTATTCGACTGACTGGACTGGCAGTGCAACAACAAATTCGCGCGAGAAATAAAAAAAAA
        AAAACGTCTTAATTCGCCGTGAATGATTTACGGATCGGTTTTGGGTTTCGCATCGAAGGCGACATTCGTTTGTGTATCAT
        ATATTATAGTATCGTATCGTATCGTATCAGACAGGCGAACAAAGGCAAATGATACTGCTACGTAACGACGGCCGCGTTAT
        AACGTTATTACGTTCGGCACTTTATTCGCGAGGCTCCACTGTGCGTGGGAGTTTTCCGAGCGGCCTAAGTGATTTTTTAT
        GGCACGCGTCTGGCGAAGATATAACTTCATAAAAAGTCAATTTAAGTTTAGTAATATTTTGCTGAATTTATAGTTGCGAG
        TATTTTGTTTAAGCATAATTTTTTATTGCCGCTTGCCTCAGGCTTCGCGAACTGGATTCGAATCCGAATATAGGGGGGTT
        TTGAACTTTTTGTTTTGGAGGAATCGCCATGAGTCATGGGAGCGGGTATATTACGTTATAAATTCAATAAATGTGACCAT
        AAAAAGGCCCATTCAAATACCTTGTCCGCGTACATTAATCCCGCTGTCCTCCGCCCCAAGCTCCCCCCTTTAACCCACGA
        TCCCCAGGACCCCCTTAACCCTTTGTAGCCACACATTACAACGCCTCGAATGCTGCCGCAAACTGCTGGAGCTGCTCCGT
        TCTTAACCCCCCTGCACCAAATGATTAATGTCTGGCAGCTCGCAGCCTTGGCGCGAGTTAAGGCCAGAAACAGAGCCACC
        ATCCAACATCCAACATCCAGCATCCAGAATCCCGGGTCCAGAGTCCGAGTGTTCCCGGAATGCCAGCGCAAGTAACCCGA
        AAAAAAGACAATACGCATAAATCTATGGGGTTGACACTTAGTACCCAAAGACCACAGACTTCAAATGAATTTGTTTTGCA
        GATCCACGGCTGACTTTAGAGGGGCGTTGGGTTCAAAGGGGGGCCAGCTGAGTGGCGAGGCGTCATAAAATTGGCAACAA
        ATTGTTTTCACGCCGTTTTAAATACACATTTTTTAGCCGATACTTGGAGACCGTTTAATGAGCGAAACCAAAAGGAACCA
        AAGCAAAGCCGAACCGGGTGACCGGAACGAGAACGGGAACGGGAACTGAGAACTGCACTGGGAGAAAAGTATAGTAAAAT
        TAACTTGTAATACTTTTATGTTTTTTGTCTCAAATAAGATTCATTTAAAAGTTATT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0088069
        2261
        FBtr0088068
        3404
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0311724
        576
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0087175
        576
        FBpp0087174
        576
        Comments
        Extended 3' UTR based on RNA-Seq and/or EST data.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        inv-RE
        Secondary FlyBase IDs
          References (0)