Open Close
General Information
Symbol
Dmel\CG42594-RD
Species
D. melanogaster
Annotation Symbol
CG42594-RD
FlyBase ID
FBtr0345704
Feature type
Associated gene
Evidence Rank
Length (nt)
5127
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GCTTTTCCGTACGGCATTCAGTCTCACGTTGAACTCTGCTGCTGTTTGTTGTCAGCCGGCTGGTGAATTAACCCCCAGGA
          CACAAACAGAAGCCAACCGATTTGGCTGAGCCAACTGAGCCGCTCAGCCAGCCGAAGGACGAAGGACCACGACCACGACA
          ATTCGCGACGTGTTGTTTAAGACCAGAAACCCAGAAACCAGAGACCTCAGGTCCTTAAGGTGTCCTGTGATCGCGTGACG
          ATAATTGTTTGTGCATCGTGTTTCGTACGAAAGAAAAATAAATTAACACTGGAAAAGTTCGCTGATCTCTGTGCGCGATT
          TTCCATTATTTTCAATAAATTGTTTTTTTTTTTTTTTTGTTTTTGTTTTGTTTTGCCGGCACCAGACCACGCACACACAC
          ACAGAGAGTGATAATGATGGTGATGAAAATCGAATCGAATAACAAGTGAATGCAACAAATGCGCATGAAATGAAAAATTT
          GTCCACACAAGTGTGAAAAACCGAAAAGTAAGAATCAGATAAAACTGAGATAATCAGCGAGCGAACGAGGCGAAGCCAGA
          AAACCCAATCACCCAAAATAAGCTGAGGGCCAAAGTGCTCCGAGAACGAACATATACCATTCAACTTCGAACCGCAGAAA
          GTAACGATTTCAGTCGACTCACTTTGGCTTGATTGATTGATTGATTGATTGATTGAACTGCGAGGCAAGGAGCGGGCAAA
          ACAGCGACCAAATGCAAGATGAACCCGGATCAACCGATGTCAATGCAAAACGGGGCGCCGCCTCCGCCCCCCTCGCAGCT
          GACCGCCCACACAATCGCCGCGTCCACCGTCACCGCTGCCCCGCCCACCGGCTCCATGGCCGCCCCCACAGCCCTGCACT
          ACAACACCGGAATGGGTGGGGGCATTCCGCCCACTTCGTCCGCCGGCGGCACGGCCGGCAACTATGTGTCCATCGGCATC
          CTGCCCAGCATGTCGCCCGCCCAGCTGCCCCCGCTCCTCCTGCCCGCACCGCCACCAGCGACGACGACCTTCAAGACCAC
          GCCCCTACTGCCCATGCCCACGCTCGAGGACATTGAGGTGGCCAACCAGACGGGCGGCCAGAGCGGTCAAGTGGTCGTAT
          CCTTGGCCCAAACTTCGATGGCGCCGCCGGGCATTTTGAAATACCCCACAGCGGGTGGCTATGTGAGCGACATGATGGCA
          CCGCCGCCCAGCCTGCCGCTCTCCATGTCGCTGCCCCATCCGCCGCTGACCTCCATTGCTGGCAGCACCGCCGGCAGCAA
          CAACAGCAACATCAGCGGCAGCAACATGAGCAGCAACAGCAATTGCGGCACGCTCAAAAGCAATGCGAAACTCTTGCCGC
          TCCAATTGATGGCCACACCACCCAGCCGCAAGGAGCCGCTGACACCCGCACATCCGCAGGCGGCCTCGATTCAGGCCCAA
          GCGCAGGTGCAGCACCAGCTGCAGCAGCAACACCAGCAGCAGCAGCAACAGCAGCAGCAGCAACATCAGCAGCAGCAGCA
          GCAGCAACAACAACGGCAGCGCAAGCGGCAGGGCTGGTGCTCCTGTTTCAGTTCGACGCCAGGAGGTGGCCATGCCGGCG
          GTGGCGTTGGCGGTGGTGTTGCTGCTGGTGAGACCGGAAAGACGCCACCCGGATACGGAAGCAAGGAGAAGAAGAAGAGC
          CGCAAGGCCACCTCACAAACGGTGTGGTCCGCCCTGCTGACAAACCTGGGCATCTGCATGCTGCTTCTCGCCTACACACT
          TCTGGGCTCCTTCATCTTTCTGACCATCGAGAACGAGGACTCGGCTTTGCTGCATCAGCAGCACACTCTGGCCAGCACCA
          AGCGCAATTTGGCTGGACTCGGGATTGGTGCAGCGGGTATCGGGAGTAGTATCTATCAGCAACAGCAACAGCAGCAGCAG
          CAAAGGACACCACATCAGCAGCAGCAGCAGCATCAGGCGGTACAGGGACGTCATGCCGACAATGACACGATGGCCGCTGC
          AGCCGCAGCTGTCGCCGCGCAGGGAACGTTGGCCGGAAGCGCCAGTGCCGGCGGGCTCAATCCATTTGGCCAGCCCGCAT
          CCAGTGGCGAGTTTGTTTACGGCCTGGATGGCATGGATGCCACCGATTTGGAGGCGGGCGGAATGCCCCAGTTTGCCCTC
          TCGCCGGACACATACGATGTGCGACAGCGGACCATTGAGAATATATGGGACATTACCGTCTCGCTCAACATTCTGTACAA
          GGAGAACTGGACAAAATTAGCCGCACTTGAAATAGCCAAGTTTCAAGACCAATTAATCAAGAGACTGAACGAGGATGTTA
          TGCTGCAATTATCGCACGACGATGTGGCCAACGCCCCCTCCTCCTCCTCCTCCTCCTCATCCTCGTCGTCATCGTCGTCG
          TCCTCGACGGGCGCCTCTGGTGTTCCGGGTAGCAACAATCCGGCCACGGAAGCCGTGCTCCTTCACACACACTATCACCA
          TCATCGTGCCGGAGGCGTTGGGGGCGTGGCAGTGGGCGGTGGACCGCCGCATGAGTGGAATTTTGCCAAAGCGTTTTTGT
          ATTCGCTGACCGTTTTGACCACAATTGGCTATGGAAACGTTGCGCCGCGAACGACGCTCGGAAGGATCGTCACCCTGGCG
          TATGCCTTCTTTGGCATCCCATTGACCTTGGTCTACCTGAGCAGTACGGGCAGCATTTTGGCCAGAGTGGCACGCGAGGT
          CTTCTCGAAGGCCCTGTGCTGTTGTCTCTGCTCAAATTGTGGCTATTGCTGCTACGACGAGAAGCGGATGGCTGAGAAGG
          AGCGACGGATGCGGCGCAAGAGGCAGCAGGAGGAGCTACGCAAACAGCAGGCCGTCATGCAGGAGCCGTATTACGTGAGG
          GATGTCTTTCATGCCACGCCCGAAAAGGATGCAGGAGCTGGAGCACCGCCACCGAATGCCGGCGGTCCGGTTGGATCGGT
          TGGTGGTTTGGGTGACATCGATTCGCTCAGTGCCAGCGAATCAAGGGGCTCCATGCACGGCCTGAGTATTTTGGCGCCCA
          TCCTGCTCTGCTTCTCCATGATGATCATCTACATCGTTTTCGGTGCTGCCGTCTTATATCGCCTGGAAAAATGGCCCATT
          CTGGATGGCATATACTTTTGCTTTATGAGCCTGTCCACCATTGGTTTTGGCGATATGCTGCCGGGACTGCGACGGGAATC
          GAATGCCACCACCTGGTTTTGTTCGGTTTACATAATGTCGGGCATGACGCTAACGGCCATGTGTTTCAATGTCATACACG
          AGGAGATTGTCCATCGCATTCGCATTGTGGTGGAGTTTAAGAAGACGAGTGCCGCTAACTCGGGCGGCGGTTTGATCGGC
          GGCGGCAGTGTGTCGGGTGGTGCAGGTGGTGCTGGTGGATCGATGATGGACGTGGCGCACGAGGAGGGTGGCCAGTATTA
          TGTGCCGGCGTCTTGACACTACGAGAAGCGAGGTCATCTCTACCAGCGCAACCCCACCGAAGAGACCCTGGTGACAGACA
          CACCCACATCGCTGGTGCTGAAGGACTACGTAAACCACGAGCTGGTGCCCATCCTAACAATGGACCCCAATGGCGCCCGC
          CTGGCACCCACCCCCGCCCCCGCCTACACGCCCGCCAACACATCGACGGGAATGCCCGGTTCGGGCGAAGTGACCACTCC
          CGGCAACAGCTGCATTGCCCACGGCAGCGACCCGGGACTGGGCTACTCCTCGCTGAGCAGTCCGCTCCTCGATGTCATGA
          ACACGCCAACGGGAGCGAATGCCTCTGGGGTCTATACACTCGCCGAGGAAACGGAACTCGAGCTGCAGGAGACGCAGGTG
          GACAGGGAGCGCATCTAAAAATGCCAACGACGAAAGTATTTAATCGACGGATCAGTATTAGTTAGCGGTTAGCCTTAGAC
          ATAGTCCTAAAACCCTAGATCGAATCGGTATAGTCTGTAAAGTGTAATGACTATTTTTTTTTGTTTTTTTTTCCCTGCCA
          CCCCAAAAGAAAATTGTGCGGGTGTATATGCCATAAGAAGAGTAATAAGTGTGCGTGTGTGTGTATGTAAGGGGGAGTCT
          TTTCCCCCACAATAAAAAAAAACCAAATATGTCCCGTTGGACCAGCAAAAAGATCGTAGCATATAAGGCAAACTATCACT
          GTACATACTATAATATTGTAGCCGAGGCGAAGATACATTTCCATAGCACCTAAGCAGATCGACCGATTGTAAACAGATGC
          CCCAAAAGGAGGAAACTAGTCAATGTAGTAAGAGTTGCGAAACGGATTTAAGTAAAGAATACCAAATAGAAAAGCGGAAG
          GATCGTATGTATTAAATTAAACTCTAGGGATTTGGAAAGCTTTCAATATGGGCTTTATTACTATGCTGTGATAAATTGAA
          CATTTATTATTGCATACTCCTGAGTCCTTTTCCAGTTATTTGAAATCCCTAGAGGTATTCGTAAGTGATATTGCCAATTT
          ACATTTACCTAATGTATTCACTTAAGTTGTTCGCCAATTTTAAAATTTGTACACAAACTTCTGGGTGGATCATCGCCAAG
          AGTTAATGTTTTAATAGTTCATACAACTGCATTTCAATTTAAAGAAATATGCTATAATTCGCAACTGATTCTTTACTTCA
          CTTTTCGATCCATTCGAAATTACATTTTCTAAATAGAGAAATTCCCCTTTTTATGTGTGCAAGCAGGGAGCTCCAGAACG
          CAACTACATAATCCGCATTACCCATACCTAATCAAGACACATTTTATACGTAAATCAAGCTTAGAACAATTACAAAATAT
          GTACTTAATACGAAATAAATATGCTACACATAAAACTATATATATTTAAATATATATATGAAACTACATCTAGGTAATTG
          TTTTTTTTTTTTGTAATTGTAATAAGCATAAAATGGATGAGTGGAGAATTAAACTATGCATACATATTATCAATGAATTC
          GAATTCATAAATTTAAATAAATGTTTAAACTACAAGAGAAAACTACGAAAAAAAGAACAAACCAAACTTGCGTAACTTTG
          TAAATGTTGAAATATACCCGATTGTATATTTATGACAAGTGCAGCAGTAAAATAAAATCAATAAAAACTTAAATGAGTAA
          AGACGTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0301749
          4812
          FBtr0345703
          4812
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0311748
          905
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0290963
          905
          FBpp0311747
          1039
          Comments

          Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG42594-RD
          Secondary FlyBase IDs
            References (0)