Open Close
General Information
Symbol
Dmel\CG34451-RC
Species
D. melanogaster
Annotation Symbol
CG34451-RC
FlyBase ID
FBtr0345808
Feature type
Associated gene
Evidence Rank
Length (nt)
1193
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CAGTTTAAAGCCATGACTTCACCTAGACGCGTCTATTATGGCCTTTTTCTGGCTTTAATTTTGTTTTTGATTCTCACACT
          CTATATTAATGTTAGCGAAGTTGATAGAAAACCTGCCAAACGAAGTAACCAGCACACTTTGGATCCCCTGTACGAAGAAA
          TCCGGATTCTTTGCATGATACCCTATAATTATAATAGTCCAGACACTGCCAAATACGTGAAACGCACCTGGGGAAAACAC
          TGCAATGTTTTGCTATTTGTGAGTGGGGATATCGATGGCGAGTTGGAACCCTATGTGCCTGTGATTAATTCCACGGATAC
          ATGGACTTTGGTCCAACAGGGGCTAATGCAGGCCTATCTGTTCTATGCCGACCAAATCGATTGGTTCCTTAGAGTCGAGC
          CCTCTAGTTTTGTAGTTTTGGAGAATCTCCGGTATATGATACACAAAAGGAAATATCAACCCAGTCAACCGATATATTTT
          GGCTACGAGCTCGAGAATATTGTTACCCATGAGTCCTTTGTCCACCATCATAGTGGGTATGTCATAAGTCGCGAGGCCTT
          AAGAAGGTATACGATGGCGTCGAAGGATCCTGAGAACAAGGAGTGCACTCATTGGGAGGGATATGTTGAGGGTCTGGATA
          TACATCGGTGCTTGAGATTTGCTAATGTAACGGTAGCAGAAAGTCGGGACGAATTTGAGCACGAGACATTCCTACCCGTT
          ACAATGGATTACCAGTTCTTAAATGGCTATGATACTATACCCTGGCTGCGTAAATTAAGTTATCACAAACGTACAGAGAA
          AACAGTTCCCATATCCAGCCGCGCCATTTGTTTTCTGGTAGAATATCCGCCAGAAATGTACGATTACTACTATTTTGTTT
          ATCGATTGAAAATCTTTGGCACTCCCGTCCGAAACTCCATAGACTTTAGGCCGTAATAAAAGACTCACCTCTGGCAGCTG
          TCGACGAACTTCCTTCCTGATGTTTCAATTACTGAAGGGCTGAGAGGGCCTTGGTTACTTCCTAGTAAGTCCATGCAATC
          CAGAGTAACCCACATATCATGTCCATCGCATAACTCATCTCACATGTGGGAAAAAGGGGGAGGATAAACGTGTTCATCAA
          TGAATCTGTCGTCTGGCCTGGAGTCTCATTTTCCCAATGCCCTTTGTCTGTGCAAAATTACTTCCGTTTTTCT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0112757
          966
          FBtr0308640
          1275
          FBtr0479781
          966
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0311794
          253
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0111669
          253
          FBpp0300863
          166
          FBpp0428114
          307
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG34451-RC
          Secondary FlyBase IDs
            References (0)