Open Close
General Information
Symbol
Dmel\mamo-RI
Species
D. melanogaster
Annotation Symbol
CG45477-RI
FlyBase ID
FBtr0346001
Feature type
Associated gene
Evidence Rank
Length (nt)
14402
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GTCGGCTTTGGACTTTCGCAGAGATTTCACACGCGATGCGATTGCAGTTCTTGCAGACACTTTCATACGTTCGCATAAAC
        TTAAACACAACAAAAATGTTTTATAAATATATTATTATAAAATAAAAAATTACAAATAAATGAAGTAACAGCGAAAGTTT
        TTAACAAAGTCAACAACAACAACAACCACACAAAAGAAGCAAGAAAATCCTTAAGCGTAATTTTTTTGTATTTCAACAAT
        GCAACAACCACAACAACTACATCTACAACAGGGGCAACAACTGCAGCAGCAACAACAACCGCAAGAACAACAACATCAAC
        AACAACCACAACAACCAAATGAAACAACAACTCAAGGCGGCTTTGCACGTGTGTGTGTGTGAACAACAACAACAACAACA
        ACAACAACAACAAAAGCGACAACAAGCTAAAAACTTTAGAAAAACTTACAACAACTTTTTTGGACTTGGAGCATTTTTCG
        AAATCTAAACAGCCTAAAGTAAATACCGAAAAATATCCCGCAATTATTTTGTGTTTTTTTCCCCATCTCAAAAACTACAA
        TTTCATTTCAAATAGAAAAACGCAAACAATTTAAACAAAAAACATGCTCTAAGGTTGTGTTAAAGGAAATTAAACCTATT
        TTGCACCTTAATTCTTTGATTTCAACAAAATTACAACAATTTTTTCCAAGTGAAAAATTTGTGCGAACCGCAGAAAACAG
        AAAAGTGGAAATAAACAAAAATCAAGTCAAATTTAATTCAATGCAAACAGCAAGTGCAACAACAACATCAACAACAACAA
        CAACCACAAGAAATTCACCCAAAACATCAACAACAACAAAACCAACAACTGCGGCAAAGGCATCAACAACAACACCAACA
        ACAAGAAGAAGAACGAGAACAAAGTTTTGAAACTGCGGTGTTTGGCGTTTATGCATATTCTTCAAAATTCCAAATTTCAA
        CGAAGAAGAAAGCGTGTAAAACTCAAAGAGAAACCAGCAAAAAGAAACCAAAAAGCTAAAGGCAAACAAATTCACACAAT
        ACGCAATCTCGGCAAATCGAAAGGCAACTCTATTACGATCAACTCTACCAACAAGATAAACACGCTACAACTCTGGCAGC
        GCTCTCTGGCTAATAAAGAAAAAAGATACAAAGGAATTAACTAGAACATTCTCTCTATCCCGCTCTAATCACACACACAC
        ACACACACACACACACACGTACGCACCATCTGTCTCCCTCACACACACACCCACAAATTCGACCAACTGGACCAATTAAA
        TGTTTATGGATACAACAACAAAAAGGAGGAAAGCATACCAATTAAACCAAATCTAAATAAAACATTTTTCGTTTCTTGAG
        GCAAAAAAAAAAAAATATAATAATAATAATAAAGGAAAAACTCTCGAACTTGGAAATAATTTCAAATTTTCGGAAAGCCC
        CAAAAAATATATGACAGTGTTGCAAAACAGCCCAAAATCAAATATTTCGGTGTGCAAAAAGTAAAATTTTTGAAAAAGAC
        GCAAGCGAAAAGTCACAGATCAGTCAACAAACAACAAGAACAACCAGCAACAAACAAAAACAACAGCAAGCTAAAAACAA
        CAACAAGAACAGCAACTGCAACAAACAACAATCCAAAATCGACGAAGACGACGGCCCCCGACAAAAATCAATTGGAAAAT
        TGAAACTTATGGATTGCTGGACGGGTAACGCCCGACTGGCGAGTGTTTTAGTTTAAGCAGCGTAAGCTGTCACCGACATG
        GGCAGTGAGCACTACTGCTTGAGGTGGAACAATTACCAATCCAACCTGTTAGGGGTGTTTAGTCAATTACTACAAGACGG
        GAGCCTGGTGGACGTCACACTAGTTTGTTCAGAGGGCACATCCATCAGAGCCCATAAGGTGGTCCTCTCGGCTTGTTCCT
        CGTACTTCCAGAGCCTGTTCCTGGAGCACCCCGAAGGACATCTAATTGTGATATTGAAGGACGTCCGTTTTGCCGAGCTG
        CAAACCTTAGTTGAATTCATGTACAAGGGCGAGGTGAACGTGCAATATTGTCAGTTGTCCGCGCTGCTCAAGACAGCCGA
        ATCCCTCAAGGTCAAGGGCCTGGCCGAGATGACGAACCAGAATACGACGCTGCGCGAACCGGAACGGGAACCGGATCGCT
        TGCGTCCGCAGGGCGGCGGCGGTAGCGGCGGATCCGCCCACAAGGCGGCCGACAGTCCGGCGGCCGCGCTTGATGCCACA
        GCGGCCACACAGGCGGCGACTGCCACGGCAACGGCAACTGCCGCGGCGGCAACATCGACCTCAACCTCAGCAACATCTGC
        GGCGGCGACGGCAGCAGCGACAGCAGCAACATCTGCGTCCACAACGGCAACGGCGGCGGCGGGGAGTAGTAATACAACAA
        CTACAACGGCGGCAACCACAACAGCAACCTGTGCCACAGCAGCAACATCTACGGCAGCAACATCCTCATCTTCGTCCGTG
        ACATCAGCAGCAGCAGCCGCAGCAGCAGCCGCATCAGCATCTGGTGTTGCGCACTCGGAGGAGGCGACCTCGTCATCATC
        GTCAACTGGCGGGCAGAAGCGGGAGGCTAGCGATCGCAGCAGTCCCACGCCCGCCAAACGATCGTCGCGAATGCATCCGG
        CGGACAAGGTGGATGTGGCAGAGGATCGGGAACAGGAGCAAAACCAGGCGGACGAGCTGCTAAGCGAGGAGCTGCTCGGT
        CGCAACTTAAAGGACGAGGAGGATGACGATGTGGATGAGCTAGATGAGAACGAGGAGACGAAGCTGAGGGGTCGCGATGA
        GGACGATGACGACGAGGATGAGGAGGAGGACACGCCCATGCCATTGGATCTCTATCAAAGACCAAATGTCGAGCCAAAAA
        GCGCCGCAGCAGCAACAGCAGCGCAGCAGGGCGGCAGCAACAGTCTCAGCGGTAGCAGCAACGCTTGCCACACCAACAGC
        AGCAGCAACAGCAATAATAACAATAACAACAACAACAACTCCAGCAGCAACAACAACAACAACACTAGTAGTGGGAAAAC
        CTCAGCGTCCAGCAATGGCGGCACAGCATCATCGGGCGGCACAGCGGACTCCGTGGTTGCGGTAGATGACGATGACGACG
        ACGACGATGGTGGCCATCATCATCAGCGACAGGTGATGGACGATCGATTGGAGCAGGATGTGGACGAAGAGGATCTGGAC
        GATGATGTCGTGGTGGTGGGACCTGCCACCGCGATGGCCAGGGGCATTGCCCAGCGGCTGGCCCACCAGAACCTGCAGCG
        TCTCCATCACACGCACCACCATGCCCAGCACCAGCATTCGCAGCACCACCACCCACATTCGCAGCACCACCATACGCCGC
        ACCACCAGCAGCACCATACGCACTCGGATGACGAGGATGCCATGCCCGTGATTGCCAAGAGCGAGATCCTCGACGATGAC
        TACGACGATGAGATGGATCTGGAGGATGACGATGAGGCGGACAACAGCAGCAACGATTTGGGTCTCAACATGAAAATGGG
        CAGCGGCGGTGCGGGCGGCGGCGGTGGCGTAGATCTGTCCACCGGCTCCACATTGATACCCTCGCCATTGATCACCCTGC
        CATCCTCATCGGCGGCGGCGGCGGCAGCTGCAGCGGCAGCAATGGAATCGCAGCGCTCCACGCCGGCCATGTCGGCGGCC
        CAGGCAGCTGGAGCGGGCGCCTCGGACCTCAGTATTGGTGGCTGCGGCGGTCGACCGGCGTCCAGGAGCTCACGCGACGG
        CGGCGGTAACGATGGCGGCAGGGGAGGAGCATCCTCCTCCAGCCTGCTTAGCCCGGGAACCGTGGCCAATCTCCTGCCCG
        TGCAATCGGTGCCATTGAGTCTCAAGAAGGAGATCGATTGCAGCGAGGACGACAATAGCAGTCACAGCAGACACATGCAA
        CAGCGTTCGGCATCAGCTGGCGGCGGCCTGGGCGGCGACCTTGACTACCGCGCCTCCCACGAGTCGCTGCTACGCAACTT
        CAGCTCCCCAATGAGCGCCATGGCCGCCAGTCGCTGCCCCACACCCTTCGCCTTCCCCTTCTCGCCCCTCGGCCTGAGCC
        TCTTCGACATCGATCCGTCCAGAATTCTCAGCCTGCTGCATCATCAGACCTGGTTGGCAGAGGAGGCCCTCAGGACACGT
        GGACTACTGACGGCGCCCAAGGACTTTCCGCACCGCTTCACGACGCTCAGCGATCTGCTGACCAAGGACTACCAACCGGG
        TGCTGGTCAACCGATGGTAACGGCCACAGCGACGGCGACCACAGCCTCCTCGACCAGTCAGGTGAGTGCCAGCCGATCCG
        GCGACACTCAGTACAACAAGCACGCACAGCAACCGCAGCAACCTCAAACCGGCGGAGCAACAGGATCTGGCGTAGGTGGT
        CTGGGTGGAAGTCCTACGGCAGGAGCGTCATTCAACCTGCGTTACCCCACGCCCACCGCCTTCTACCAGCAGCAGCAGCA
        GCAGGGTAAGGGTGCCAAATCGTCGCCTTCGCCCCAGCAAATGGCCACCAGCTCCACCACAGTCATGTCCAATGATTCTG
        GGGAGGATAGCTGCAAGCGCAGTTCGGCGGACAGCGATGAGGTGACCATTATGGAGCTGCCCAGCGAACGCAGTGCCCAG
        CTGTACAAGGAGTCGCTGGAGCAGCTGCTGCAGCGCCAGCGTCGCACTCCCATCCTGGCGGGCTCGGGATCAGGCTCTGG
        TTCGGGTACGGGATCGGGCAGTGTTATTGTTGATGCCGCCGGTCTTAGGCAGTATACCCAACTTTTGTTAGCCGGAGCCG
        GCTCTGGTGGTGCTTCCGATCTGAAGGAGAAGAGCTCCTCGTCGTCCACCTCGTCCACGCCACCGCTACTCACCCAGCAG
        CTCAGCCAGATGCTGAAGAGTCCCTCGGACACGTGCTCCTCGCTTTTCAGCTCGTCGGGCGGCGGCACAGGATCGACCGG
        CCCGGGAATCACCGGCGAGACCATCGAGGAGGAGACCCGTTGCGTGGTCTGCAATGCCCACTTTCCGAACGTGTGGCTGC
        TGGAGCAGCACGCGGCCCTCCAACATCCCCATGTGGGTCCCGGCGAGGAGAAACCGTTCATTTGCGAGCAGTGCGGCCAG
        TCGTATCGCTATCGCAGCGCCTACGCCAAGCACAAGGAGCAAAATCACCGTGCTCGTCTGCCGGCCGACAAGCTCTTCAC
        CTGCGACGTGTGCGGCATGCAGTTTCGCTACCTGAAGAGCTTCAAGAAGCATCGCTTGAACCATGCCCTCGAGCGACTCC
        ATGGCAAGAAGAGCGTGGGCGTGATCGGACGACTGGGCGGATCTGGTTCGGGACCCAGTTCATCGGCGATTTCCGTCTCG
        GTGGCGGCACCTACTTCCGTTTCCGCCTCTGGATCGGTGACCTCGGTGGACCAGGATGTGGTCACCAGCTCGCAGGAGCC
        CATGCTGGCCGACGAGGGTGAGGATCTGCGCGTGAATGTGAAACGCGAGGGTACCGCCGATGAGCAGAGCGCCGAGTCGC
        GGGCCAACGACCTCGAGGAGCACGAACAGGACAACACCGTCGACTCCGCGGGCATCACGATGCTCTACCAGGACAACAAC
        TCCTCGGCCTCGGCCTCCACCAGCGCCACCGAGCCGAACATAAGCAGCTCCGACGGCATTCATAGTACAAACAAGCGGTC
        GCGCCTGCACCACTTGGAAACGGATCCCTCCTATCCACACCATCATCACCACCACCACCACCATCACCATCAACAGCAGC
        ACCACCAGGCGCAGCATCAGCACCACAATCCGCAGTCGCAGCTGCCGACCCACTTGGGCCACGTTTCACTGCCACTGGTG
        GCCACCTCGGCCGCCGGCTCCTCATCTTCGGCGGCTGCCGCTGCCGTTGTGGCCGCTGCCCAGGCACAGGTCAGTTCTGG
        CGCCACCGGAAGCGGCGCAACCGGAAGTGGTGCACCCGGCAGCGGCAACGTTGGCTCAGCAGGCAGCTCCGGTGCGGGCG
        GCGGCATAAGTTCCCTCAGCTCGCTCACATCCCTGATCAACGCCGAGCGCATTCCGAACGAGCAGTTCCTGGGACTCAAT
        CCGCAGGAGGCATCCATCCTCAATTTCTTGCGCGTGGATGCCGCCGAGCGACAGAGGGACAAGCGACCGGCCACCTCGCG
        ATTCGCGTGCCCCTTTTGCGGCAAGTGTGTGCGCTCCAAGGAGAATCTGAAGTTGCATGTGCGCAAGCACACCGGCGAAA
        GGCCGTTCGTGTGCCTCTTCTGCGGACGTGCCTTCGGTGGCAAGTCGGATCTGACCCGCCACCTGCGGATCCACACCGGC
        GAGCGGCCTTACCACTGCGAGTCCTGCGGCAAGTGCTTCGCACGGGCGGACTATCTATCGAAGCACCTGACCACACACAT
        TCACAATGCGCCGCGCTGAGATGAGGCGCGTAGGAGACGGCTCCTACGCAGATAAGGAACCAGCTCCATGATCAGACACG
        CTCACACACCAACACACACACTAAATACAGGATATAACAAAGCCGTTGTGTATAAATCCTATTATTACCAGAAGCTCTAC
        GATTAGATCGATGTAAGACACATTTTTTCGCTAGAGTTTTTTGTTTTTTTTTTCTTTTTTTTTGGTGCAAGCTAGAGAAA
        AACAAAATGACGGGCAACTAATTAGCACGGGTATTAAAGTGTTTAAGATTCTGAATATACACCTATCTCTCTAAAATATA
        AATATTATGTGTGGAGTAAGGTTTACGATTATAATTACGGATTATAATTATTATCGTAGCACAAGATTAAGTTTTTCTAC
        AACTATGATTAAGTGCAGATGGTAACGAAATGCGACTTGGTTCTGTGAGACAAATTATTTCTAATTTCTAATAACAATAA
        CATTAACGAAACAGCCACAAACAAAAAATAGCATCAGACGACACTGCAATACCAATTAAACAAAATAGTCTGTATTTTCT
        ACCGAAACAAATGAAGTACCGCAGATCTGCCGTTGATATACACAATAGATAAAATATATTTAATTTTACACCGATCTATA
        GAAGCTAACTAGCAACAATTTGTACAAAACAAACAAAAGCCGAGCAAACGAGAGGAAACTAACTTTGCAAGGATCAATGC
        AATAACTGAGTAAACTCTGTTACCTACCACAGAAAACAATAAGCGATATGGGATTTTAGTTAATTCTAGTACAGCAACTG
        TACTGGAACTAGGCCAACCACTAAATACTACATGTAAAAAACAATGTTTCAACGATGCAAGTGCAAGCATTATTTATTCT
        TCGGTTGACCGATAATATACACATATGTTCAGTATGGAGGCGTAGTTGGTTTATAGGATTATTGTAAAGCTAGGAGATAC
        GAATGGGATCTACCACCGTCAATAGTTTAATTTATATACATACAAAGCAAAGCAAAGCGAAGCAAGGCAAATCAAAGCAA
        AACAAAACTAAATAAAAAACAAACATAGCAACAATTAACAATTACCAATAGCAATTACAATTAAAACTGCAACTGCATAC
        ATGCAACTACAACAACACAAAACTAACTGTGATCACAACAAGAGAAGAACATTGAAGTTTTAACTAACCTACAAACAAGC
        TAAACAGGCAAGAATAGTTTATAGCGATGGCAACCATGGCAAGCAATAGAGAAATTGGACGGTGCTGGCAATCCTGCAGC
        TGCTGCATCGTCCATCCGCTGGAAACGAAATGTGCAATTAAACAATAAAAACAATAAACTAGAGAAAGCCCAAAATGATT
        TCTCAACCGATATTTGCTTCATTTTTAACTTAGTTTAGCAGACACATACATACAACCAAACAGGAAAATCAAAAAATAAA
        ACAACAAGCAACCTTGAACCAAGAACATCGAATTAAAGTGTAAAAAAAAAAAAGTGAAGAAATGAATCCGAAAAACTCAA
        ATGCGTAGAAGGGTAGAATTCGAAGTTTTTTGTATTTAATAAATGTCTAACGCAATAAGGAGAGTAATGAGAATTGCCGT
        ACCAAAAAAAGTGGAAAGTAAAAAAAACAAACACTGAGAACAAATCAAAGTAAAGTGGTAGAAGTAAAGTAAATGAAAAC
        TTTCACTGTGCCAAAAAGTTTCAAGTACCTCATAATTTAACTAAATATTAAAGAGAAGCAACTAACCACACCGAAAACAG
        CCCACACAATCCACAAGCAGTCCACACACGATCCACACGCCCCCAAATAATAATTATACAAACATACATACATATATCCC
        GTAACGAAATGAGTCTAGACAGGAATTGTCAAAGCGTATGATTACATAGAAGCTGAAAGCTGAAAGCGAAGCGTTAACTA
        ATCCTAATTTACCAATCGGAGAGGGCTAGAAAATAGTTAGTTAGATAGAGATAGCGATAGACCTAGAGATAGGGACGGAT
        ATAGAATAGAGACAGAGACAGAGAGAGATGGCGCTGGCGATAGCGATAGCAAGAGAGAAAAACAGATAGAAACCGATTCA
        GCGCATGTGGAGATCTACCATCCAAAGGGGATCCACATGCATCGTATATCGTATATATCGAGCATGATGTGGGATCCCCG
        ATTTTCGATTATTTTTTGTAATTTATTTATTCTCCAGCAACACAGTTCTGCCTACATTTTCTCTCTCCAAACTTAAGTGT
        TCAATCTTAGCGAATATATATTTTTGCCTTGGAATATATATGTTATGTGATAGTTTAACTAATTAACCGCACACCTTGAG
        TTATGCCTTTTTAGCAACAACATACTTTGCCTAATTATTATAACTTGATTGTAGCGAAAAGACAACAAATCACTTTATTT
        TCTCGATATATATGATATAAGTTCTTTCAATTTCGATTGTGTCAGTATGTGAACCGTCAAAGATCAGGGCCTCTAGCAAA
        TGTTATAGTTTTAGTTCATTATTATTATTATTATTATTATTACTGATAATCTGATGTGAATTTTTGAGCGGAACTTATTA
        TAGAATTACCTTTCTTTGGTTCTCGATTTCTACTTGAATTACTATTTATTTTCCAACAACAACTACACTGCAACTGCAAC
        CACAAACAGAAATCAAACACTGCCTTTTGTAAAAAAAAAAAAACACAAAAACCAGCAAGTATAATGCAAAATTTGTAATC
        TTACTATCTTAAGTTACTCTTTTTTTTAAATCGTAATATTAATTTTTTTATGTTCACATCACAAATGCCGAAATCAATTT
        GAAAAACTCTGTTTTACTTTATTTTTACTTTTATTTTTTTCCAAGCTCTACATTAAGTTTTTAAGCACAATAACAATAAC
        AACAACAACAACAACAACAACAAGCTGTGAGCTGTGTATGTGAATGAATTATTTGTATGAATATTATTACAGTTATGACA
        CTCTTATTATTATCAATTTTTTTGGAAACACTTATTATTTTGGAATTATTATTTGATAGTATTTATTAATAAAGTTTTTT
        GCAACGAACACATTATTGTTTAACCATCTCGGGCACATCCGTCGATATGAAACCATCCGTCGATTTTCACTTCCTTGGTT
        AACCCACTATTTTGTATGTTTATAGTTGAAAATGCGCCTTAAAAGAATTTTAGGAAACTAAGGTAAGAATAGTGGAGGGG
        CAAAACAAATTGTGTCATAAATACTCCATTTCGGTAAGATACAAAAACGTTTAATGTATTTAAGGAACCCAAAAAAAAAG
        GAAAGCAATATTAACTGAACTAAAGAAACCAGTAAAGCTAAAGTAATTTTTTCTTAGGTGTGCGTGTGCAAATAAATGTT
        AATGAAAAATAAAGAGAAAAAAAAAAGAAAGGAAACCTATTAAAACCATAAAATGCAAAAATAATCACCATCAAAATTAA
        GGCGAAATTTAATTGAATAGCGAGTACTGGAATTTTTTTTGTGAATGTTCAGAGCGGAAGGAGAAAAAAAATTGATTTTA
        AGCCAAAAATTGGAGGGATTTAAGACTCTTATTTCGTATATACATACATATACCTATATTACAAATTTACCACGTAGGCA
        GTTTTTTTAAGGCATTGACAACATGCAGGAAAATACGTGTAACAGAAAATTACATTACAAAATTCAACAACGAAAACTTT
        TGGCATTACAAATTAATGCATTTTTAAATACAATATTTATTGATATACCTAGATTTAAAGTGCAGCAACAACAACCAGGC
        GAAAGCGATGCGAAAATTCCAAATAAGACGGAAATGGATAGAAAAAAAAAAGCATAACAAAGAAATCCAAATATTATACA
        TAGAATATATCTATATACAGATACATAAATGTACACGTGGTTTTCGGTGTCTATTACTTATATAAATAGATATATATACA
        TACATTATATACAAACATCATATTATACACATGACGTGCATATTTTGAAACAAAACCTAAAAACCCCCAAAAAGCCCAAA
        AAAAAATCAAATATAAATGTTGTTCATTTGACTAATACGCGGAAGCAACTCAACCAAACAAAAATATATATTCTAGCATA
        TATATAAAAAAAAACTAATGGTATTCCACTCCCACACGTACACTCACCACCAGGGACACCCAAAATAGGGATATTTATTC
        CATTTATTTCATATTTTCATACATACATATGTATTGTAGTTTACTTAATATGGATTTCGCGAAATGCATTACACATAATG
        TTTATCTTGTCGCAATTCCTAGTATAATTAAAGAGAAAGTCCTACCGCAAGCTTTATTATCCTGATTCAAACCACATCAG
        TTACTTTAGTGCTTGGGTGTCCCCAGATCATTTAGCAAAATACATGAAAGTTTTAAACGTAATAATACAATTTAACAAAA
        ATAAAACTACGATTTCATGAAATTAAGACAATTTCAAGGTTTCACTTGCAAAAAAAAAAAAAAGAAAAGGAAAATGGAAA
        ATGGAAAAGTCATACCCATATAACAATGTTCTATATTGTAGTCAAAATCATTTTAATCAGTTTTGGATACACTTTGATTT
        TAGTGTTGAGCAAAATGGAAAGAAATGAAACGACGATTTCGTTACGATGGAAAACAATTTTAACTTGTCTAAAACCAATT
        AAATTGTTAACAGCAACTAACTCATGTATGTAAATACATTAAATGGATACCATCTTCAAAAAGAAAACCACAAAATATAC
        AAAAAAAAAAAAAAACGAAGGCGATTGCAAAAACGAAAATGAAAGATGGATAGCAGAAGCATAATAAACATAAAATGTAG
        TACATGCAATATATTTTTCGGTGTTAGGCGTCTTTTTGAGATTTTTACAGAATACCAGACAAAAGTCCCTCAAACAAAAT
        CTATAAAGTATAATATTTCATTGTTGATGTTGTGAGCAAACTAAAGGAAACTAAACCAAACCAAACCAAAACTAAAGTAA
        ATTGTATTTATTTCTCCTACTCTCTCAACAGTCTCTCTCACCTAAGCTCTAAACTTTAGCTGTCGTGTCTCTTTAAATAT
        TTATAGGGGTTTATAAGGTTTATGAACAATGGAAACAATGGAAAATGTTTCAAAACATATTTTTTTTTTTTTTGATATAT
        ACATAAACAAGAGATTCGGTGTCTACAAATTATACGAAACCTAAGATGCAACTAAGGAAAACATTTTTAGATCAAATTCG
        AGTTGTTAAGCGATTGAATGGCATCGGAGTTGAATGGCTGGAGTTGAAAAGCTGGTGTGGCAATTTGGGCAAATGGGAGG
        AAATACTTAGCAATAATTCTGAAATGACCTCAATCAAATATTTTTTAAATTTTATATATTTTAGTCGTGCAAAGGAAAAC
        CTAAATGTGTAAATAAAACTTTAAAAATACATACAAATCGAAATAGCAAAATAAACAAAGAGTGTAAAACAAAAACAAAC
        AAAAAAAAAAAAAAAGCACATAAAAATGTCTCTCGAACGAACGAAGAAAGAATGTGATATTTTTCTAAGGTGTACTACAA
        AACAAAATGATGAAAACAAATATGAAAACTAAAATCAAAGATGCAACAATTCGAATAAAATATTTAACACTTTTACTGAG
        AACCAGAAATAGAGCAAGCCCACATAAAATAGAACAAATTGCAATAGAGACTGATTTTTGACATCATCATCTCATCGACA
        TTCTCACCACCAATTACAATACGAACATTTTTCATCAAACCCAACAACAACTTTTACTACAGTTACAGTTTTGAATAGGA
        AAAAAAAAACTGGTTAAATGGTTGGTTCAGATGCGAAATCTCCTTTGATTTTCCAGTCTGCAAGGACGAAGTGAAGGATT
        TCCACGCATAGTTTTAGGTGCCTCTTTGGGTTGCTTTAAATCGGCGGGGAATTGCAATCAACATTATATTTTTCACTTCA
        AAGTATGGACTATAGATTCATTTGAGTTCTTCGAGTGCACAGTGGACGAGGGAAGGGGAGAGAGTAGGGGAAAATATGAA
        AATATGGGTGCGAAAGGTGGAAAGGGAATTAATGGAACCAATTCGAGACGCATCGCGTCAAGTTTAAGGTTTACAGATGG
        GACTTAGAAGCAATGTTAGTTTAGGCGTGGCAGGGCGTAGAGTTTGGTGCATTCGCACAGAGTTGTAATTATTTTTGTGA
        TAAAATCCGAAGCGCAATTTTTTTCTCCAACTGTATGGTAGGTTAGAGGTCTGTACATAGGCGGGGTGGAACGGGAGAGA
        AAGAGAGAGAGAGGGGGTCTGGGGTCATGGGTTAGGGGTCAGGTGGGTTGAGTGTATGTTTATGAAGGTGCTACGAACAA
        AGACGTAATTGAAAATGTGATACAGTTTTTTCCTTAACCTATTTATTGAACGGTACGCAGAGCAGGGGACGGAAACGAAG
        GCGGAGGAAACGGAAATGGTACGGGAACGGAAGCGGAAACAGAAACAGAAACAGAAAAACGGAACGATAACGGAAGCGGA
        AGGAGCTTAGCAATATGCTTTACAAGCAAACAGATTTCTATTCTACAGTTTTAACGGTTTTTTACGGGAAATGTGAACGG
        AAAGCGTAGTGGGTTATTTTATTCGGTTCAATTCAACCTTACTTCGTTGACACAGAAAATCGAGACACCACAGATAAAAA
        AAAAAAACGAAACAAACCGCAACCACAACAAAAACAGAAATCAAACAGCAGAAAACGGTCAGAGATGTATTGGGGAAAAT
        TGTAAAAAATTTACACTTTAGGAAAATCTCTAAATTTTAAGCTTTCGGTGTTTTTAAACCAAAAATAAAATTAACAAAAA
        AAGCAAAAACGGAAAAGGAAATGCAAAAAAAAAAATACAATAAAACAATGGCAAAACGTATAAAATTAACAAGAACAAGA
        AAAATTAGCGAAAACACACGAAAAATTTATATATATACATATATATTTCGATATTTAAAACTTCATTCGGAAAGAAAAGC
        AAAAAACATTAACAATTTTGAGCAAACTCTCGGTGTTTTAAAATTAAGCGCATGCAAAGCCACATTACACTAAAAAATTA
        ACTAAACCCAGAGTAAACAAAATAATAAGTTAAGCAAACAGACGTAAACCAAAAACAAAAACCTCTTTCACTTTCGTGTC
        TTTGACTTAAAACCAAAAAACTAAGGCGACAAAATAAGCAGAAAAAAAAACCAAAAAACAAAAAATATTAAGCATATTTT
        TAAAATGTAATTTAGCACAAAAACAAAACAAGACAAAATCAAAAAAAAAAACCAAAAACAAAGCGAAAACGCAAAAAAGA
        AAACACAATTTTTAAACTACCAACGTATTGATGTGTATTTGATAACAAAATCAAAATTGTAATGAATTGAACAGGACATA
        AATGGAAAACCAAAATATTTGAAATGGAACTAATCAAATTAAATGAACCATTTTTTTTCACATCTCTCAGATATTTCGAA
        TCTTACGTTTTTCGGTTTCGAATTCGAATCTTGCGTTGAGAACGATTTAGAAGGAAAACTTTTACAAAACTACGAAATGC
        AATGCCTGCCAAAGAATTAATGTTTTTAATGCGAAATGCAAAGGGAAACGATAAACAAATATTACTTATATGCAACCAAA
        CAACAACAACAACAACAACAAAAGTTCAATAAAGCCGTTCCAATAAAATGAAACCAAGTAAAAACTGAGAACTAAAACAA
        GCAACAAAAATCAAACTTGTTCGGAGATCTTTTGCGTTTCCTTATACAAAGACATTTACGACGACTAAACCAAAGAAAAC
        CAAAAAAAAAAAAAGAAAAGAAGGAGAAACACGAACATTTTTTTTTTTTGCCACTCAATTAATGAATGCAAAAATTAAAT
        GTGAAAATCAAGAAAAAACTATTTGTCGTGTACAAGTAAACTTATTTGTATTCCACTAGTAAAGTGAAATGTTTATTGGT
        TTTATTTTATGAAACAAAACAAAACAAAACACCACCATTTTTATGCATTACATTATAAAAAGAAACAACAAGCAAATAAA
        AT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0346007
        4583
        FBtr0346004
        5359
        FBtr0346003
        15683
        FBtr0346005
        4535
        FBtr0346006
        8765
        FBtr0346002
        9885
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0311880
        1553
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0311886
        799
        FBpp0311883
        1087
        FBpp0311882
        1087
        FBpp0311884
        1109
        FBpp0311885
        1109
        FBpp0311881
        1553
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG45477-RI
        mamo-RI
        Secondary FlyBase IDs
          References (0)