Open Close
General Information
Symbol
Dmel\NetA-RC
Species
D. melanogaster
Annotation Symbol
CG18657-RC
FlyBase ID
FBtr0346088
Feature type
Associated gene
Evidence Rank
Length (nt)
3339
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACACACACACAGTCACCCACACGCATACACGCACGTGCAGACGACACCTCGCGGGAAACCGAAAAACCGAAAAAACGAGC
        GACGAACGAAAACGAACACACAGTCGCCTGTGGACAAGCAGCCCGACTTGACGTTACGAACCGAACGCCGCCGAACGAAC
        GGCGATTTGAACGACGCGATTTGAGATTTTGTATTGGAGATTTGCGATTTGCGAATTCGAGTGGCTGGAGTTTTGAGACG
        CGACGCGCGCTTCAAAAACGCCTGCGCAAACAGCTGCCAAAGCGGCGATTTCGAATTTTTTTGAGTGTTCAAGTCTGTTA
        ACTTCAAAACTATTGGCGCGATTGACGAATTTTTTGTTTAGTGCGACTCTGGTGACTTTTCAAACTATTGAAAATCACAG
        AATTTGGAGTTCTTGTTCAAATTCTAAAATTTTTGAACGGTTTTGAAAATTGCAAGGTATTTTTATTTGTGATTTGCCAA
        GACAATTAAATACCAAAAAATTAGTGATTTCCAAAACTACAGAACAGTTTTAAATTTATAATTTTGAAACTACGTAATCT
        TACATTATCCAGTGCGTTTTTTTTTAAACTAAAAAAAACTGAAGATTTCGTTTTGTTTTGAGTGATTAAAAAAAAACCAA
        CAATACAATACTGGCGAGTTAAGCAAGCCACTAAAATTGCAAACATGATCCGTGGAATCTTGCTCCTGCTGCTGGGAACC
        ACCAGGTTCAGCCCCATCCAGTGCATCTCCAATGACGTGTACTTCAAGATGTTTTCGCAACAGGCGCCGCCGGAGGATCC
        GTGCTACAATAAAGCGCACGAGCCACGCGCCTGCATTCCGGACTTTGTGAACGCCGCCTACGATGCTCCAGTGGTGGCCA
        GTTCCACGTGCGGATCGTCGGGTGCGCAGCGATATTGCGAGTACCAGGATCACGAGCGCTCCTGCCACACCTGCGACATG
        ACGGATCCGTTGCGCAGCTTTCCAGCCCGCTCGCTGACCGATTTGAATAACTCGAATAATGTGACCTGCTGGCGCAGTGA
        GCCGGTGACCGGAAGTGGGGACAACGTAACCTTGACCCTCTCGCTGGGCAAGAAGTTCGAGCTGACCTATGTGATCCTAC
        AGCTGTGCCCGCATGCTCCGCGTCCCGATTCGATGGTGATCTACAAGAGCACCGATCACGGGCTCAGTTGGCAGCCATTC
        CAGTTCTTTAGCTCCCAGTGCCGCCGGCTTTTCGGACGTCCCGCCCGCCAATCCACTGGACGCCACAATGAGCACGAGGC
        CCGCTGCAGCGATGTCACCAGGCCACTGGTCTCCAGAATTGCCTTCAGCACACTGGAGGGACGCCCATCGTCACGGGATC
        TGGACTCATCGCCGGTGCTGCAGGACTGGGTGACGGCCACCGATATCCGGGTGGTGTTCCATCGCCTTCAACGCCCCGAT
        CCGCAGGCCCTGCTCTCATTGGAAGCCGGAGGAGCAACGGATTTGGCCAGCGGCAAGTACAGTGTGCCCCTGGCCAATGG
        ACCCGCTGGCAATAATATTGAGGCGAATCTCGGTGGGGATGTGGCAACATCCGGCAGTGGATTGCACTATGCCATCTCTG
        ACTTTTCGGTGGGCGGACGGTGCAAGTGCAATGGACACGCCTCCAAGTGTTCCACGGACGCCAGTGGGCAGCTGAACTGC
        GAGTGCAGCCACAATACCGCTGGAAGGGATTGCGAACGCTGCAAGCCATTCCACTTCGATCGTCCATGGGCCAGAGCCAC
        CGCCAAGGAAGCCAATGAGTGCAAAGAGTGCAACTGCAACAAGCACGCCCGTCAGTGCCGCTTCAATATGGAAATCTTTC
        GGCTTTCGCAGGGCGTCTCCGGCGGAGTCTGCCAGAATTGTCGCCACTCGACTACGGGCCGGAATTGTCACCAGTGCAAG
        GAGGGATTCTATCGGGACGCCACCAAACCACTCACCCATCGCAAGGTTTGCAAAGCCTGCGATTGCCATCCGATCGGGTC
        ATCTGGCAAGATCTGCAACAGCACCAGCGGTCAATGTCCCTGCAAGGACGGGGTCACCGGACTGACCTGCAACCGCTGCG
        CTCGAGGTTACCAGCAAAGTCGCTCCCACATCGCCCCCTGCATAAAACAACCACCGCGTATGATCAACATGCTGGACACC
        CAGAATACCGCTCCCGAGCCGGATGAGCCCGAATCCTCTCCAGGATCTGGTGGCGACCGCAACGGCGCCGCCGGAATGGC
        CGCCCAGTCTCAGTACTATCGCACCGAGGGCGGCAGGGAATGCGGCAAATGCAGAGTCAGCACCAAAAGGCTAAACCTAA
        ACAAGTTCTGCAAAAGAGACTACGCAATAATGGCCAAAGTAATTGGTCGCGATACGAGCAGCGAGGCGGTCAGCAGGGAA
        GTTCAACGGCGCGCAATGGATCCCGACGTGGCGGACTACGAAATGGATCAGGTGCAGCCGGGATCGGCCCGATCTCCGAT
        CACGGGGGTGTACGAGTTTCAGGCGGCGGACTATCCCAATCCCAATCCCAATCCCAGAGGCAGCGAAATGGAGCGCTTCG
        ATCTGCAGATCCAGGCCGTCTTCAAGCGCAGCAGGCCAGGCGAAAGCAGCGGCGCGGGGAACGTGTACGGAATGCCGAAT
        ACAACCCTAAAACGCGGTCCTATGACCTGGATCATACCGACTAAGGACCTGGAGTGCCGCTGCCCCAGGATCAGAGTAAA
        CAGATCCTATTTGATCTTGGGTCGGGACTCGGAGGCGCCACCCGGTTACCTGGGCATCGGACCGCACTCGATCGTAATCG
        AATGGAAGGAGGACTGGTATCGACGCATGAAGCGCTTCCAACGGAGAGCGCGTACTTGCGCGTAATCCTCCAGCCAATAA
        CAATACCACATCCTGTGTGTAGTCTCAAGATTCTAGAGCTAAGAAATTATTAACAGCTGAAAACAATCAAATCGTGTCAT
        TGTCTCTTAAACACAATTTTTTTGTTTTTTTTTTTTTTAATGTCATATTAACCGATTTTGTAGCAGTTAAAATCAAACTA
        GCTGTATTTAATTTATTTAATTAACTTCAATCGTTACAAAGCAATCGGTAATTGATAATTTGAAATCAAACGCACGAAAA
        TATCTATACATGTAATCTACGTAATCTATATATATACGACTTGTATTATTCGCTAAATTAGGATTCCTGTCAGCCCAGTT
        TAAGCATTTGTGAACAATTTACGTACTAGGGCCGTCTCGAAATCAAACAGAGCGCCAGTAAGCAATAATTTATGTGTAAG
        AAGCACTTTGATGCATGCATGACTCGCAAAAATAGTAATTAATAAATATTGTACAGAGC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073942
        3245
        FBtr0308337
        3249
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0311922
        726
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073759
        726
        FBpp0300656
        667
        Comments
        5' UTR based on RNA-Seq data.
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        NetA-RC
        Secondary FlyBase IDs
          References (0)