Open Close
General Information
Symbol
Dmel\CG12177-RC
Species
D. melanogaster
Annotation Symbol
CG12177-RC
FlyBase ID
FBtr0346119
Feature type
Associated gene
Evidence Rank
Length (nt)
1509
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 34 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GTGAAATACAGCACAGATATGAATTGAATTGCACACATGGTGACATACCACCGAGTATCGCTATCGCCCACCGCACATGT
      CAGCTGCTCAGTTTAGTTTAGTTTAGTTGAGTTTAGTTGAGTTGAGTCGGAGAACGAGCGTTATGAAATTCCGTGATATG
      GTGCTCTGGTAATACCCATGCCCATACCCATGCCCCAGAACCATAACCAGAGCCAGAGGCACACTCATAACCGAGGCGAG
      CCGATAGACGAAGTCCGGCGGCGGAGGCGACCAGATGATTGCCGTATGTGCATACTATATGGGTAGTCCGTAGTCCGCTG
      TTCGGGCACATTCAACAATTGCCGGCGATGGCGGACGGACGCATAGTGGAAAACGGCAGAGGAGGAGGCGGTGAAGGAGT
      AGCAGCAGCACCATCGCCCAGATACGCGATCCTCGACTGTGATGGGGGTAGCGACGATGCCTGGGCACTGCTCCTGCTTC
      TGCATGCGGCTAAGAGCCATGGGATTCATCTGCTGGCCATCACCACAATGGGATGCGGCAATACCAGCAGGGAGAATGCG
      GCACGCAATATGCGACGGATTCTGGATGCCTGCAAGCGCACAGATATTCCCATATACCTGGGCGCCGTAGATGCCCTCAT
      TCCCTCTCTGGAGGATGAAAAAAAGTATTTCCATGGCCGCGACGGATTCGGTGACTGTCTCACCGACGACTGCGCTCTTC
      AGTTGGAGGACATCGTGCAGGCGGAGCACGCAGTGACAGCCATCCATGATCTCTGCCGTTCCAGGCCCAAACAGATCACC
      ATATTTGCCGTGGGCCCGCTGACGAATCTTGCCCTGGGCTATACGATGTACGGTCCGGAGTTTGGGAATAACTTTCGTGA
      TCTGTTCATTATGGGCGGCAACTATCAGGGCGTGGGCAACTCCTCGCGTTCGGCGGAGTTCAACTTTCACTCGGATCCGG
      AGGCGGCGCACACGGTGCTGCTGAGGACACGCTGTCCCATCACCATACTGCCGTGGGAGGCCTGCCTCCCGGAGAGATTC
      AATATACACATTAACTGGCGCCTGAAGGATTTCGCCGCAAGGGCCAAGGAAGCCGGACATCCAGCAATTACCATGCTCAA
      CCAGGTGGAAGCCGCCCAGTGGCTGCCAATGATCGAGCAGTACGGGATCGATACGTGGAATCCATGCGATGCCATTGCCG
      TGGCCGTTTGGCTATTCGAGGATCACTTGATCCGGAGGCACAACACCTGGCACGCCACCGTGGATCTGCGGGGCACCCAC
      ACTCGCGGCCAGATGGTTCTCGATCATTTGCGGGAGCGCGAAAAGTATCCGGAGAACGTGCGCATTATCGAGCTGGTGGA
      TGTCGAGTTCTTTAAACGGATCTGCGAATGGATCGCCGGCTTGGATGACGGCGCCCTACTCCGCGACACTCAATAAATCC
      ATATCTCTAGTAATTCCCGCCTTTTTCTTCGGCGCTATCATTTGATTCCCCCATTTATCAACGGTTCAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0073846
      1805
      FBtr0340399
      1210
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0311948
      362
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0073677
      362
      FBpp0309345
      362
      Comments

      Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

      3' UTR based on RNA-Seq data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG12177-RC
      Secondary FlyBase IDs
        References (0)