Open Close
General Information
Symbol
Dmel\RpS8-RF
Species
D. melanogaster
Annotation Symbol
CG7808-RF
FlyBase ID
FBtr0346158
Feature type
Associated gene
Evidence Rank
Length (nt)
726
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 784 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      Sequence
      GTCTTTTCCTTTCTTTCTCGCTTTTTACTCGAACATGGGTATTAGCCGCGATAGTGCACACAAACGCCGGGCCACCGGAG
      GCAAGCGCAAGTCGCTCCGCAAGAAGCGCAAGTTCGAGTTGGGACGCCCCGCCGCCAACACCAAGCTTGGCTCCGGCCGC
      GTGCACAAGGTGCGCACCCGTGGTGGAAACACCAAGCTCCGTGCTCTGCGCCTGGAAACCGGAAACTTCGCCTGGGCCTC
      CGAGGGAGTGGCGCGCAAGACCCGTATCGCCGATGTTGTGTACAACGCCTCCAACAACGAGCTGGTGCGAACCAAGACCT
      TGGTGAAGAACAGCATCGTGGTCATCGATGCCACGCCCTTCCGCCAGTGGTACGAGGCTCACTACGTGCTGCCCCTGGGA
      CGCAAGCGTAACCCCAAGCACGCCCAGAAAGAGGACGAGAACGACGTGCTGACCAAGAAGCGCAGCGAAAAGGTTATGAA
      GAAGTACCTGGAGCGCCAGAAGTACGGCAAGGTCGAGCAGGCCCTCGAGGATCAGTTCACCTCCGGCCGCATCTTGGCTT
      GCATTTCTTCCCGCCCCGGACAGTGCGGTCGCTCCGACGGCTACATTTTGGAAGGCAAGGAGTTGGAATTCTACCTTAAG
      AAGATCAAGTCTAAGAAATAAAGGCACTAGATAAGCTTGCAAGACATGATTTGCAAACAAAAACGGAATAAAACAACTTG
      TTTTTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0085489
      1045
      FBtr0310274
      756
      FBtr0346159
      931
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0311986
      208
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0099686
      208
      FBpp0301957
      208
      FBpp0311987
      208
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Extended 5' UTR based on RNA-Seq and/or EST data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      RpS8-RF
      Secondary FlyBase IDs
        References (0)