Open Close
General Information
Symbol
Dmel\RpS8-RG
Species
D. melanogaster
Annotation Symbol
CG7808-RG
FlyBase ID
FBtr0346159
Feature type
Associated gene
Evidence Rank
Length (nt)
931
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 784 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    Sequence
    GTTAAGTTTATAATTAAATAAGTGCTCCTGTTGTATTCCAAAATACATGTCCTGATATATATCTTAATTGTGCTAAAAAT
    TAATATTTGAATTAATGTAACAGCACCGAGTGTACTGTAGAGCGCGCGCTAACAGCGCAGAGTTGCCCAACCGCGGCAAC
    TGTCAAAAAGATAACCCTACTTTTTTGACACGAGGTGCTGTGCGTGTCTTTTCCTTTCTTTCTCGCTTTTTACTCGAACA
    TGGGTATTAGCCGCGATAGTGCACACAAACGCCGGGCCACCGGAGGCAAGCGCAAGTCGCTCCGCAAGAAGCGCAAGTTC
    GAGTTGGGACGCCCCGCCGCCAACACCAAGCTTGGCTCCGGCCGCGTGCACAAGGTGCGCACCCGTGGTGGAAACACCAA
    GCTCCGTGCTCTGCGCCTGGAAACCGGAAACTTCGCCTGGGCCTCCGAGGGAGTGGCGCGCAAGACCCGTATCGCCGATG
    TTGTGTACAACGCCTCCAACAACGAGCTGGTGCGAACCAAGACCTTGGTGAAGAACAGCATCGTGGTCATCGATGCCACG
    CCCTTCCGCCAGTGGTACGAGGCTCACTACGTGCTGCCCCTGGGACGCAAGCGTAACCCCAAGCACGCCCAGAAAGAGGA
    CGAGAACGACGTGCTGACCAAGAAGCGCAGCGAAAAGGTTATGAAGAAGTACCTGGAGCGCCAGAAGTACGGCAAGGTCG
    AGCAGGCCCTCGAGGATCAGTTCACCTCCGGCCGCATCTTGGCTTGCATTTCTTCCCGCCCCGGACAGTGCGGTCGCTCC
    GACGGCTACATTTTGGAAGGCAAGGAGTTGGAATTCTACCTTAAGAAGATCAAGTCTAAGAAATAAAGGCACTAGATAAG
    CTTGCAAGACATGATTTGCAAACAAAAACGGAATAAAACAACTTGTTTTTT
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0085489
    1045
    FBtr0310274
    756
    FBtr0346158
    726
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0311987
    208
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0099686
    208
    FBpp0301957
    208
    FBpp0311986
    208
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    Extended 5' UTR based on RNA-Seq and/or EST data.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (1)
    Reported As
    Symbol Synonym
    RpS8-RG
    Secondary FlyBase IDs
      References (0)