Open Close
General Information
Symbol
Dmel\rtv-RD
Species
D. melanogaster
Annotation Symbol
CG1397-RD
FlyBase ID
FBtr0346379
Feature type
Associated gene
Evidence Rank
Length (nt)
1186
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTATGCAAGCATGCAATAGTATCGATACTATCGATAAATTAATCTAGCTAGCATTATTTTGGAATATATTTTTGAAATAA
        TTAATCGTTGATAAAATTAGCTTTTTACCTTTTGGATTCGCTGGAATTCCAGCGCCTGGTAACACTAATTCACGATTAAA
        CTTCCTTGACTTAACATTTACATATATTTACTATTATTCATTATTATCATTATTGACTAGTTAGTAGGCGAAATAAGAAG
        ACGGGACCATGCAATTTACGAGCCTTTTACTGGCTGTGATTTTTCTCATAAGTCTGGTTTCAATCGATGGCCTTCTGCGC
        CGCTGCTATCAGTGCCGATCCCGTGGCGAACTGGGCAGCTGCAAGGACCCCTTCACCTTCAATGCAACGGACGTGGAGCA
        GGAACCGGGAGTGGCGGCCATCCCGTGCGCCAGCGGCTGGTGCGGCAAGGTGATCGAGGGCGGCGGCACCTATGCCATCG
        ACGACTACGACCTGGCCATCCAGCGGATGTGCGTGCAGCGCGGTCCGGACGACAACATGGATCGCTGTGCGGACACCATC
        TACAACTATAAGAAGGTGTACATGTGCTTCTGCCAGGGCGACCTGTGCAACGGCGCGAGGAGCTGGTCCAGTGCACCCCA
        GATGATCCTCATCACCATGCTGCCGCTGCTCGGCTCCTGGCTGCTCCAGCGGATGCGAAACTAGACTGTTTGCTTTCTGT
        GCTCTTAGCCGGCAATGTGTATATACATCTTCCAATACTCAGCAACACTCAATGTAATATCAACAGTTCGATAAATACAA
        ACAATTTTTTGTTATTACTTAAAATCGAATGTTCTTGCTCTGCTTAAGATTTTATTGCCGTTTACTCGTGCATTTTTTCG
        TATCATTTTTCCGATCGCAAATAAGGTACTTACATTCAATATGTAACCATTGATTATGGCTATATATGGCATAGATCCCG
        ACTTCGGGTCAATCAGCTATCAGTGGAACAGACTCGATTGTTTGCGAAAAAGAAACAATATGAATATTATTCATATACCT
        AATTAAATCACTCCTGCTGCGTAACACCATTCTCTTTGTTTGCAAATAGAATATCCATTCGTTTTAATTAGTATATTTAT
        AAAATAAGAATATAATAATCATTTATATAATCATATAATCATTTAAGTAATAATAAATTTTAATAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073470
        1063
        FBtr0331742
        1006
        FBtr0331743
        964
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0312073
        151
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073326
        151
        FBpp0304131
        151
        FBpp0304132
        65
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        rtv-RD
        Secondary FlyBase IDs
          References (0)