Open Close
General Information
Symbol
Dmel\CG12012-RC
Species
D. melanogaster
Annotation Symbol
CG12012-RC
FlyBase ID
FBtr0346532
Feature type
Associated gene
Evidence Rank
Length (nt)
1185
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AACTGATTGCGGCAAAACAAAGAAAACGCAGAGAAAAAGTTAACGCAATTAAACGTAGTAAAAAAGCCTAGACTATTTTC
        ATAACAAGAAGCAGTGAGTCACAAAAAAAAGCTTTCCGGCCACAATGGCAGATACCCGTAAAGACGCCGCGCCGCCGAGC
        TACGAAGAAGTCATGAACAGTCCCTCGCAGGATTCCCGGCTGATAGTGGGCGTGCATCAGGGAGCACCTAGTGCTCCGCC
        ACCAAACATGCACATGCCAACCTACGGAGCTTTCGAGACGACGCCGGTCAGCGTGGTGATTCAGCCTGCTCCGGTCGCTA
        TGCCCACCGAGATCATCGTGATTGGAGGATGCCCTGCATGTCGGATTGGATACCTGGAGGACACCTTCTCCGCCTGCGGA
        CTGTGCTGCGCAATCTTCTTCTTCCCGCTGGGAATTCTCTGTTGCTTGGCCATGCGTGAGAAGCGCTGTTCCAACTGCGG
        AACGGTTTTCTAGAGGGGATTACCCAGAAATTATCCATAAAGAAACGCTAAAAGTTGATCCCTATTAGGCTTTCGCGGTG
        GGTGACTATCACAAAGCACCAATATTTTTGTTATTGTTAATCGTTAGCTCGCAAATCATTATATACTATGTGTAAATATT
        ATTCATGCCAGCCTGCGGAATGCCCCCGATTCCATTCCAGTCCCTGTCCGGAGAATGGTCATGTACAGTGAAATATGCTA
        AACTCGAATTCAAATCAGTAAGCCCAGTTATGAAAAAAATGCTAAAAAAAATCAGTTGAACATGTTTTCCAATTGAATAG
        TGATTTGGCTTTTTACAAGGATTTTAAGTAACATAAGTTTTAAACTGCAAACAAAAGAAAAAATATTTATATATTTAAAT
        AAAAGGTTTACAACATGTTTATTATATCTTAGAGTAATGGTACGCAGATATAATGACTTGGACGGTTTTAGATATGAACT
        AGGTTGTACAAAACTTCATTAGTTCTTGATTTGTGAATAATTTGACCCACTGTTGCATTTCGTGATTATAGAACTTTTAC
        TGTACTTGTAAAATGTGCACTGTAAGCGTCGACGAGGCGCGCTTCCGTTAAATTCAATTGAAATATAATGGAGGGCGGTT
        TTGAATTGCGCCGCCCGTCCGATTTCTCTTCTCCATGCTCTTTGGACTTTACCGCGCAAAACAGT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073076
        880
        FBtr0300749
        931
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0312150
        122
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0072938
        122
        FBpp0289973
        81
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG12012-RC
        Secondary FlyBase IDs
          References (0)